Description :
From Genome Similarity Track
Location :
Scaffold_421:12821- 15135
Sequence
2314 bases(100 bases per row)
CATTCCCCCCCCCTCCCGTCAAGTGGATCCGGATCTCTTCCTCCCGCTTATCGATGCTCCGCTGGGGTTTGGCCGCGGAAGATAATCCTTACAGGGCAAT
ACTGTGAGACTGCCTGGATGGGAAAATTTTTCCGTGCCAGATCCACTTACGCGGAAGGCCTCACTCGTCAATGAAGCGGAATAATGGGCTCCTGCTGGGG
TTTGGATCTACTAAAGGGACAAGATCCAAAAAGGCTGGTGATTTGTGGGGATTCAAATTTGGTGATCAGACAAGTGCGAGGTGAGATTGACTGCAAGGCC
CCGGCCCTAGCACTGTTACGGCAGAAAGTGATGATCCATCTGCGTGGTTGGATGAATCACGAATTGGTGCATGTTAAACGAGATTGGAATGCCAGTGCAG
ATAGATTGGTCAGTGCCGCTTTACGGAATCAATGCGGTGTTAAAGTGGAGAGAGAGGCCGAGCATCAGGATCTCGTTACGTTGAACCGACTAGACGAAGT
GGTGGTAGCTGGATCCGGGAAAAGGACAGTCCAGGTGATGGCTGTCACTAGGTCCAGAGGAAGGATTGGATCCTACCCCCAGATCCTCGAGGAAACATTT
GTGAAGGGAGTCCGCATTGAGCGGATCCTCAAAGCACAGAACGAGGAAGCGTGGATTTTGGGACTAAAGAAGTATCTGATGGGGGATGTACGAGGCCTGA
GTCGGGAGGATGCCAAATCCTACAGTATTATCGCTACGGATTACGCAGTGGATCTGAATGACTTGCTCTTCTATTGCCCCCTACGAAGAGAGTCCACGAG
GATCGGAATGGATTGATGAGATTGGTGATGCCAGAAACCTTGCAACAGCATGTCCTACACCACTACCGCGCTAGCTTGGAAGGCGGGCATCAGGGTATTG
GTCGGACCTACCAACGGATCCGGGAATGTTTCCACCGGAGAGGACTATTCAAGAGCGTACAACGATATGTCGGTGAATGTGTGGATTGTGAAACAGGCAA
GGGCAGGCCCACAATCGAAGGGGAATCACCTGGGAATATCCAAGAGACTTACCCTTTCCAAATCATAGCCATGGATCATATCCCCTCGTTGCCCAAGTCG
TTCAAAGGAAACACAGAGTTGTTGATTTGGGTGGACCTGTTTACCGGATACGTGATAGCCAAGGCTAGTGCGTCTAGAACTGCGCAAACCATTGCCGAAT
CGTACGAGGAGTGTGTTTTCCGAAGGTTTGGAGCTAGCGAAATGATTAGACATGATCGGGAGCCAGGTTTTATGTCTGATTTCTTTCGAGCATTCAACCG
GATCCTGGGGCACCGACGGCGAGCAACCATGGCATATCGTCACCAAGCTAACGGGTCGGCCGAGCGCATGGTACAGACGATCACGAGAGCACTCAAGATG
TATGTCCAGGATTTGGATCAGAGGGATTGGGATGAGTACGCAGAACGGCTCCCCTTCGCGATGAACACCGCCCAAGACAGGATCCGGGGTGATACACCAT
TTTACTTGGTACATGGGTGGGATCCCAAATCCACCCTAGAAGCAGCCATTCCGGTATGTAGCACCAAGAAGAGAAACCGAGATCCAAGGCGATGGCGATA
CCAAGTCCAGAAATACTACCAGCAAGCTAGATCCCAGGTGAACGAACGACTGCGGAGTGCGATACAGGATCGAGCGGATCGACACAACGAAGACGTCCAC
ATCAAATCCAGGTGGAATCGCAGGTGTGGCTTTATTTGGATCGAGTGAAAGAAGGGTACGCTCGCAAATTGGCCCATCTATGGGCATGGACCGTTCCGGG
TGAGAGAGAAGATTGGAGAACGTGCGGTAAAGCTGGAAACGGCAGGTACCGAATATCGCCTGTTCCCTGTAGTACACGTATCCAAGCTGAAGTTGGTCAA
AGAATATCCGGATCGGCCGCAGATCCGTCTTTCGGTGGATGAATCCGACCGGGTGGATTTCGACGAAGTCCTCCTACCGGAAGATAGTTGGAATGTGTAT
CTCGAAGCCGACGAGTTCGAAGTCGAGAAGATCACCGATATGAGGTCGGGGAAGCGAACTAGATACGGACGGATTTACCGTGAATTTCTGGTGTATTGGC
GTGGATATGACGAACCCAGTTGGGTAGACGAGGCAGATCTGAACTGTGGAGCATTACTCTATGATTTCTTGAGGGATCGTACGAATCGTAACAGATTCGG
CGTGATGCAGTCTCATGAAGAAGAGTAGGGAGGGGATCCATGGATGTGAGTTGGTCATGTCGATGGGAGGACGAAGAAGGACCCACAGGAAGGGTGTGGG
CCAGGAGGAGGAGG