Description :
From Genome Similarity Track
Location :
Scaffold_13:128203- 135708
Transcript NameFunction/comments
Aphas_H257_05685kinesinlike protein putative
Aphas_H257_05686Hypothetical protein

Sequence
7505 bases(100 bases per row)
ACCTGCTTGGTGGTTTTATTGTAGTTGTGGATGAGCACCGTAAACACCGAGTGCGACCGCGAGCTCTCGGCGTTCATTTTCGTCGACCCGACTTGTCTTT
TTTTATTGGCCGCTACACGACACAAAAGATATTTCATATCTATCTGCCAGGCATATATATATATATATATATATAGATCGTTCGTAGTATGATACCGTCA
AACATTCGCAGCGTTTGGTGGGCCGACGTGCACTCTTTGGACGCGGCGTTAGTGACAACGACCATGCCTTTTTCGTTCTTTTTGATGTCCAGCTTAAGCG
CCTTGTCTTCTTTGTAGGCCGGATCCAACTGCGCCAACAAGTCGATCAGCTGATCGTTGTACAGCTCGAGCATGCTCGCTTCGTAGGAAATTGATTGGTT
GGACGCTAATATCAAACAAATACATCAACTACCGGGGAAAATGGATATATATATTATTGAAATCGTATGGGTTACGATACCTTGAGACTCTTGCAAGGCA
AACATGAGCTCGATCAACCGCTTGGTGATCCCTGGATGTGAATCCGTGCCTACATACGATCCATATGTTAGTTGAAACCTCGTTACAAGAACACTTGATA
ACTCCCACCAGTCATCGTAAACGTTTTGCCAGACCCGGTCTGCCCGTAGGCAAAAATGCACACGTTGTACCCGTCCAATGCCGACTGCAGCAAGTGTTTT
GTGTCTTCAAACACGTGGTCCTAGTATCGAGAAGGATCAACAAGGTATTCTTCAAGAATAGTCATATTTTTAATATATATATATATATATCAAAATCCAA
TGTCCAAGCAATCAGCGTACTTGAGTATGCGACGGATTGAATACGGCGTCGTAGGTAAAACTCCGCGGGCCACGTGCCGTGTCCACTTCGAGCGTAAACT
ATGCACACCGTTACATGCGATACAAGAACAACCTTCGTTTGTTCACTCGATACAAGCACAACGTCGTACGTCGTCTAGGAACCGCACGCACGAGTGGCAG
TTCCGGTCGAGTTCGCTGGAACTCATAGGGCGACAGCGGCAGTAGACTCGGATTTTGCCCTTCATGTCCTCGATCGTGTTGTAATATTTCTTGCGCAGGG
CTTGCTCTTCCTATAGTACTCGATAAGCACCATTATGTTTGACGACGCTCGATCCCATCAAGGCTATGGTTAGCATGTACTTTGTATTGGGATTCCAGTG
TCGCGTACTGCTGCGTCAGCGTATTCAAATTGGTCGTTAACGTTGCGGCCGTCGCCTACAAAAAAATCGTATATATACATTACAGGATATGATGTATTTA
ACATGCGATTTCGTACGGCTTCAGCTTGCAAGCCCACCATATCCTTCTCCAGCTGCGATAGCCGAGCGGTTTGCGTGCGCAATGCCGTCACAGTTGTCGT
GAGCTATATATACCATACATGTCGTTAAGCTCTGTTTTGTTTCTGTGTGGCCAATCTGTGATTAGGCACCTCTTGCACTTGATTCGTCAAGTCCGAGACA
GTCGCTGACGCTTGCACCAGCTCCGTTCTACCAACCAATAAATACTCTTACGGCATTTCGGTTGCTCAAATCAAAACAGACCTTAATGCTGTAATTTGGC
GCGTGGACTGGGTTTGCAGGTCGTCGACCACCTTTTGCGCTTTCTTTTCAGCGTCCGCTAACTTCTTCGTCCACACACGATCGGACACGGCATCCCCACC
GTCGCTACCGCCTTTGCCTCCTACGTTAAGCGTCGTTTTGTATTCCTAGTCTCACCGTATGTTCCCCACACAATTGATTGTACCTGCATTGTTGGCCTTG
GTCAACGCCTGCTCCAACTGATTCAACTTGACGCGGTCGGCCTGCGACATTCAAAATCGTCCTTAACTCCGTATATGAATCCCTCAACTCTACCTTCCAC
TTGGACTCGACCACTTTGAGCTTTTGCTTGTACTCGTTGGCGACTTTCGTCGAGTTGGCAGATCCGTCGCTCTAGGTCCCAGTCATATTCAAAGGAGAAC
TCAACTCTGCATACTACCCCAGTAGCTAGAGTGTTTGTGTTGCGTTGGGCTTTGGCTTGCACTGGTGGCGTTGTTGCCAGTTGGTGAGCAGCTACGGCAG
AGTCAGCGTTTGGGTGGCCAGCAACGAACGCATCCAACGCCTTGCGCAGGACCACCGCGCCTTTGGCTGGTACGACCGTCGCGGCTTCCGCCACTGCCAG
CGCCACCACGTCCCCTCCAGGGACATTTCTAAGATACATGTCATATTTTGAGTAATATTATATATATATGTGTGTGCTCACATTGGAGCGATGGCGTGGC
ACGCCGACAAGAGAATGACGTGGCAGCCTGCCTTATCCCCTTGATTCCATGCGACTTTGCCAGCTTCGATGGCTGCTTTGGCGCGTTGGACGGCTGCTCC
CAGCCCGCTCCCGTCGACGTCGCCTTGCAACTACATAGTAACATTATTTCACGTTAGTTAATCGTAGTTAAACGGTATGTGCAGACCTTTGGCTCGGCAA
TTAAACTGGTACTACTAGTATTTCCACTGGAGATGTCTTCTCCTTCGTCTGGGGTCGTAGAGGTAGTACTTTAGTTAGTGTCCTGCACTTGACGTCGTAT
TGCAGTGCGAGTAGCCACTTCTGGAGCAACTAAGAGGGTTACAATACCAATATCAAGATCGTCATTCTTGTCGTTATCCGGATCCAGATCATTTGACGTA
TCGTGGAATGTGTCGGCTGCCAGAGTTGCCGCACTCGACGAGGCGGCTTGGACTCGCCATGACAAAAGCTCCTCTGCTCGTATAATGTGAATAAATATAT
ATTATACAAATATTGATTTATTTTTGATATTAGTTACACCAAGAAGCAACGTCATGTATATATTTATATATATAAATATATCAGCCACAAGCAAATAGCC
ACCTAACCTACCTTGTAATGCCAATTGGGTTTCGATCAACGAACGAGCGACTTCATGCTTCAAAGATGGCACGACGAGTTTGAGCGTGCAAATTATATTG
ACGTGAACATAATATAGATATATATATAATCATCACTCATTGGTCAGTACCTCTGCAGCCAACGCTGCCTTCAACTTTAAAATGGACGCCTTGTCCTGTG
AACAAACGTATGTCATAAGGACGAGCATATCAGGTACTGTACGTCTAGCAAGGTTAAAAGTACTTCTATCGAGGGAGACTGGGCCTTTTCTGTAGAGGAA
ACTTCGATCGTGTGAGCTTGGGAAGGCGGTTGTGTGTCGTTGGAGGTGGAGAAGTGTCCTTGTAAAGAGGTTCGTTTTTGTGCGTCCTTGGAAGGGGCAG
CCAGCGACACATCGGAGTGTTCTGGCGACGCTGTCAACGGCAATACAAGGGACGAACTATGTTCTTCAATCAAGGGCGGGTGTTGAGGTTGGATCGATGA
CAGTGGTGCTTCTAACAAGGGCTTGCCGGGCTGCGACGATTGTGTCATGGGAAGCTGAATGGCAGGGCCTGGCGACGCATCGAGTGCTTGTATCGAGGGT
TGCGAGACAATCCTTGGGGATGTGTTTGTCGTGACAGGTCCTTTTAACGAGGGTTGACGCTCAAGGACGACCGCCTAGGTTCACTCCTAAACATCAAACT
AGTCGTAAATGACACATACCGGTTGGGGGCGATGTTCTTGCACCGAGGGGTAATTTGAGCTGTGTGGTTCTTGTATCGAGGGTGGTGTTTTGAGGCGCGA
CTGCAGCGCGTCCACTTTGGCTTGGGCGTCGTCCAACGCGGTGCGTAAATGGGCGACCTACGGCGTTGGAATGGGGAAAATTCCTCGTTTTGTCACGTGT
TTACCAGTGTGTGGTGGGGAAATTGCCTCATGTTGCCCGAGCCCTGCAGCGTCTCCACTTCGGCCACTTTGAGGTCGTATGCGGCTTTGGCTGTCGCAGT
GTCCTGGCACAGTCGATAAAAATGAATGAATGAATTTAAATATATCTTTTTTGAGCAAAAGCGGCAGATATTATTTCTCATAAGGTAATATACAATGCAT
GTTCACAGTACTTGTTTGAGCCGCGCGTGGTCGTCTTCGGCTTGCTTGAACGCCACGTACAAGTCCTTCACCTGTCATATTGTCCATAATAAATAAATAT
AAAATATTACAGGTTTATGCTTACTACATCAAGTGAATATCAATTTTTGGGGAACACACATACATACAGTACCTGCGCTTTATCCGTCAAGGTCGGGTCT
CGGTTGTACTTGGCTTGAAAGTCATTGAGCCATTCTGTCTCAAATGATTCAACTGACTGGAGCTTTAGTTATTGGGCTGTGCCTACCTTTGATACGCTGC
TTGGCTGCGGTTTTGGTCTGAAACACAGCCGTGCTTTGCCCTATATGTCATGGTATAAATTATATTATTCAATACATCTATATTTTGCAATATATATATA
TACATATATATATTGCAGTATTAGTTCACGTATGAACCCTCGACCTTTGAGCGTATCCAGCTGCGTCTTGAGCACTTCCATGTCCATTTCACATGCGATC
AAGTGGGCGTATTCTTGCGGGGGCTACATATTACAAACAATATATTCCAACCCCGTATTTAAATATATATATATATAATATTAAAACCAACATACCTCTA
ACGCCACGATACTTTTCCACTTGGTGCCATGATGAAATGCCGCCGCCATTTTCGATGGGAATGGCAGGACTTTGGCTGCCGAAGTTCTGCTCGTTGCTAC
ATAACTCGCTCAAGAATCCACTTGCAGGGCTCAGTGAGTACGTTGTATAGTATCCACCACGTCACAGACGACGGTCGCCAGCACTGCCGCCACCTGCGAC
GTCACCATCAAGTCGTCGTACATCGCTTGAGTGTGCGCAATATCAGTCTACACATTCGAAAGGCCAAGCTGAAAAATCACTAACACCACATCTCATACCT
TAGCTTGGCGTAAGACTGTTTGGAGGCCGTGAACATCTGACATTGCGAACGTGAGATAAATAAATAAATATTTATATATATACAATATTTCATACCTGCT
TGGTGCAAAGCGCGGTCGACAAGCCAGTCCACCCACAGTCGAGCGTCCAACCCACAAGTGCTGGTGTTGTCGTTGTCGCTTTTTATTGGCTGAGTTGGAT
TATCTGTAGCCATCTCAACGGATCTCAACAGCTGGACTTCCCAACGCCAATCTTCGCTCCTATTCATTAATATATATATATTTATTGGTGGTGTTTCGGG
TTTAGACTGTTAGTACATGAGGCCACAATGCGCCAACGCCCGCGCCGCATTCTCTCGCTGCACTCGCGCCACGGCACTCAGTCGGGCCAGCTCCATCTCG
TACGCTACAAAAATACAAGTCAAATGAGCCATAAACCATACATATTCAGAATCACCATATCACATCATATATGTAGTATTTGTGTCCAATAGATGCATTA
AATTCGTGTAAAATTGATATTTTCACGCCAACCAATCATCGCAATCCGTACAATGTCGCAAGGCTAGCACGTCCGCTGCATGCTGATTGGCCAGAGCATC
CCGCTCCATGAGCCAGCTGTGCCACTCCGCCGCGTGGCAGCGGTCGTGCTCGGCCATGGTCTCTTGTAGCTGGTGGAGGTCGTTCGTTGCCTCGGCTTTG
GCTTGGTCTGTAGTAGTAGTACATGGTAAAAAATATGCTAGTGCACTTGTCGTTCGTTATATTTAGTTTAAAAAAATCGAAAATCCCCGAAACCAACCCC
TTGCGGCAATATGAAATACTACGTAGTACTGTTTATACTACCTGTCACACATTTAGAGTCAATTGGAGACATGAATGAATGGTGGGGAGGGCAGTAGTTT
ACCACTTTCGCTTTGTAGGCGGGAGTACTGCTGCTTGTGCATCTGAACTCGGTCCAACGTCCGCCTACGATGTATCGATCACAGGCTGGAGCACCATAAC
GAATATCTCCATCCTTCTCAAAGACTAGAAACGGAATACCACATCACGTCGAAAAGAGTTGTTCACACCACAGCATATACAACTTGATTCGGTACCGTTT
CAACTCGCCCACGAACGCTTCGTAGTGAGCTTTCGTGGACGCTTCGATCTTGTTGTATCTGTCGACGACAGTGGCCAGTTTGGTCGCGTGGTCTGCTTGC
AACGCGTGCATGTCCTGCACTACACGCTCCAAGTGCGATCTACCAGACTTTCGTGTAAAGAGTTGCAAGTCCATGGAGGGAGGACCTCGCCAATGCGACG
GGGATGTAGGCTGTTTCATTCGCCTCAACGATACAAGCTGCTGCTGCTGGCTGGTGGTTAGACGAGCCAGCTTTCAAAGGCATGGCAGTGGCAGCTAGCA
CCTTGCCTTGGTGAAATGCTCGGGTGGTCTGCATCATGACAGTCAGTCAGCATGTGGGGGTATAGCATTAACCTTGGGATGACGAGACCTGTAAGTCCCA
GCCAACGTACATGTTGCATGGCGGCCGCCGCCTCACCAGTTGAGACGGTTTCAAGTGATAACGGTATTGTCAGATTCGTCGAATAGTACTATCAATAATA
ATAATACTAAGTTACGATGTATTAATACTACTTTGTTAGTAATACTATAAATATTTATATTAATAGTTTTAATATCTGTGAGATTAATTTACCCGACTAG
TACTACTATTAGTAATACTATTATCAAGTTTTTAACATTTTCTGAAAAATATTAATAGTATATAGTATTAATATCTGTTCAGAATTGTGAGATTAATATA
CCCCACTAGTACTACTATTAGTACAGTACAAAAGGAGATGGAATCATCCTTGATCCTGGAATATATTCAATGCACCATGAAATGGCAGCTTATCTTCCAG
AGAGCGCAAATTTGGTCGCTTGGAGGGCGACTTGCGGGTTCGAATGGAGGTATGCTTGCGCTGCTTCCTTGGAATCGGCGTACCCTGTAGTCGGGTCGGC
GTCCTTGCGGACAGCGCCAGAGGCGAACTCGGGGTGCTTGAGCATGATAAAGAGGTTGAGGAACGCGTTCAGGCACATAAGGATGCCGGCCACGGTGCCC
ATGGCGGACCCCATGCCGAAATCGAGGAACCCGATGAAGAAAATGAACCCGGCGCGGCCGTTGTACGAGAAGAGGAACCCAAAGTTGGCTCGGATGCGGC
TTTCCATGCTCTTCAAGCGGCACTCAAACAAGAGGAAGAGCAGGCCGAAGAGCACCACGTACATAGATAGAAGCGCGCCCGTGACATTCAGCGCGATGAG
GTTGAACACGCCGCCGATTCCAGCCACAATCTGGAACACTGAACAGAACACGTTGCCAAGGCGCATGAGCCGAAGTACGCGAGAGATGTCCATGTTCTGA
ATGGCAGCGATGCGTTCGGATAGGGTTGGGCCTGAAGGCGGCGGTCCCGCGATGGACGTAGACGACGAAGACGAAGGCGGCGCCATGGCAATTGCGGTGC
GGGTCGAAATATGGGAATGTGGGGTAGAACTGGGGAGTGAACCAATGGGAGATCGTTAACGCAGAATGAAGCAATTGGATTGGTAGATACTAAAAAAGCC
AGGGA