Description :
From Genome Similarity Track
Location :
Scaffold_2929:1282- 2583
Transcript NameFunction/comments
Phyta_totarag14943Amino Acid/Auxin Permease (AAAP) Family

Sequence
1301 bases(100 bases per row)
TACGCGTCTCGCCCTTTTTATCGCGTATCCGCTGAGCACAAAAATTAATTAATACACGAACAAAAACCAGCTCGTTTCCGGTGACACGCTGTTCGTCGTA
AAGCAACGTGTACGAGTCGTGTTGGAAGACGACTTCTAAAAGGGAGCACCCGAGGCCACCGCTCGTGTACATGTCTTAAAATACATGGGTACTGATGCAT
TTTAGACGCGCGGAACCGAATACGGGGATGCGTTTCGGGGCAGGCCAATACGGGATGCAATCCCATTCCCGTCATGCAGTGCATGATGCATCGGCCGGGT
GTCATGCACCGGAACGTCGTGAGTTGCTGCACGGAGGGATGGGcgcggagcagcagcgctccgTCTCGGTTAACGGGTGGCCACCTGGTGCCGCGTATCC
TTCCACTTCAGTTATCATTaattttattaaaataatgACATGCGAGGTGGCATCCCATCGCCGCCGTGTGTGGACGAAGTTACCTAGCAGCTTCAAAATC
GTCTTCAGCCTGCCACACATgaacatgtattaatagcgaCCTCGGGTCTTCACTCAGTGAAGTTCACTGCAGGTTCTTCACTGCTGCGTCCGTGCTTTGC
CTTCATGTGGTGCTCCGTATCTTGGTCAGCAAGTatctgctctgctctgctctgtTGCAACGGCAACTTGTTGCAAGCAGGGACATCAGCTCACAAAGTG
CAGAGCCTCAGGCTACACTGTACACCGGTACAGTATGAGGATCAGCCGCTTCTAATCCTTGGCAGTGATGCAGCCAAGTTGTGCCCGGCACTGGTGACGG
ATACTTGCGCCCAGTATGCTTGCCCCGAAAAAGAGCCGTCAAACGCATCGGCTCTGCTCGGGCGAGCTCAACACCCTGCGTGAGAAAGGCAAGTCTGCAG
CGGCGGACCCGAAGAGATATGTAAATGGTCGAGTCGCTCTTCGTTTGAGTCTCGCTCGCGATCTAACTCTCTCACTTTGGAATTTTTCTTCACTCGGAGA
agtccgcagcagcagctcgtcgctcgACCTTCTTCCTTCGTCTCGTTCGTTCCACGATGTCGTCCTCAAACGGCAAGACTGCCTTCTTCACGAtggagga
cgccaaggcgTCCTTCAACCTCTTCTGTTGCGTGTGCGGTATCGGTTCGCTGGCCATGCCTTCCAACTACGCGCGCGCCGGTCCGTTCTACGCATCCATC
GCCCTGGCCTTCATGGTCTTCGCCAACACGTACGCGACGCTCAAGTTGTCCaaggtgatgctggtggcgccgtcgtccgtgaaGACGTACGGTGACCTCG
G