Description :
From Genome Similarity Track
Location :
Scaffold_3007:1282- 2441
Transcript NameFunction/comments
Phyta_totarag15002reverse transcriptase

Sequence
1159 bases(100 bases per row)
TTGAACTCGTACAACAGCGTTCCGCAATTCAGCTGAGACACAGGCAACCACTCAGGATCGGGATATCCTTTCCGTTTCACCAAATATTCTCGAACCCTCC
GCAAAGTGTGTGTTCGCTTCACCCATCGGACATCTCGGATCGCTTCCACTTCATATCCGTCATGAGCTTCATCAGGTCCACCAACATCTTCAGGTAGCAG
TGCAGCATCGAAATTGTCTCCTTCAGTTACCTCCACTTCAATTGTAGGTCGGTCTGGGAAGACTGCACGTGGTTTGAGTCGACTGGCGTGGACCCACGGA
TACAGCTTATACCCAGAACCCTCGATTCTCAGCTTGCAACGGAAGTCATCTGAGGTTTCCATGATCCGGAACGGGCCATGCCACAAGTGAGCGAATTTCT
TAGTCAGTCCGGGTTGAACTCGCGCTAGATACAGCCAGACAGCGTCCCCGACCTTGAATCCTTGCTTGAGCCTCTCAGACAATTCTTTCCAGATTTTAGT
CTGAGCCTCCGAGCGTTTCGACTTAGCTTCGGCTTGGAGATCCTTTGCCCAGGCTTGAGCGTACTCGTACTGGCGCTGAACATTCCGGCGCCACTCATAC
GCAGTCCGCTGGTCTAGGTCAGTAGGAGGAGCACCTAGCATGGCTGATACCGTACTCTGAGGATCCCAACCGTGAACGAGGTAGAACGGAGTGTCCAGGC
GAGTAGCGTCGAAGGACGTGTTCAGTGtccacatcaacttctccacttgGTCGTCCCAGTCACTTTGATCAGGCTCCGAGACATACGCTCGCCCAGCTCG
GACCACCGTCTGCACAGATCGCTCTTGCTGACCGTTGGCTTGAGGTCGATACGCTATGGTGGCTCGTTGTTGACTTCCAAGCATCTCACGAAACTTGGTG
AACACTTCGCTCATGAATCTCGGATCTCTGTCGTGATGAAGCATGACACTTGCTCCAAACCTCTGGAATACACACTCCATGTaggcttcagcaacttcct
gagccgtcgtggtgctcataGGCGTGCAGATGACGAAACCAGCAAATGAACActgaaacagcagcagaaaaacGTTGCCTCGATCGGTCTTGAGCAGATG
CGTAACGAATCCATGGAGACCACTTCAAATGGACGTGTCGCTAGGATATTTCCAGGCGA