Description :
From Genome Similarity Track
Location :
Scaffold_88:12819- 13903
Transcript NameFunction/comments
Phyke_g5190mitogen-activated protein kinase, putative

Sequence
1084 bases(100 bases per row)
ATAGGCGATATCAATTGATTCGTGCTATCGGGCACGGAGCGTACGGGGTTGTCATCGCAGCGAGTGACCAAATCACGGGCAACTCGGTGGCAATCAAGAA
CATACCCCGTACATTCGACGACCTTGTGGATGCCAAGCGCATTGTACGCGAGATCCGACTCATGCGTCACATGCAACATCCGCACGTCGTAACGGTGCTA
GATGTGATGCGTCCGCCATCGCTCGATCATTTTGAGGACACGTACATCGTCACAGACCTCATGGAAACCGACCTACACCGAGTCATTAACTCGCCTGAGC
CTTTATCAAGCGATCACATCGCTTTTATCACGTACCAGCTTCTATGTGGGTTGCGCTACGTGCACTCAGCGCACATTATCCATCGCGATGTCAAGCCATC
AAACGTGCTAATCAACCGCGACTGCTTGGTAAAGCTATGCGACTTTGGATTAGCACGTGGAATTGATATCCGGCCTGTCACACCTTGCAGCACGGATGGA
GCCAGTACACCAAGCAGCCAAGACGGTGAGCCTGCACTAGATGAAGCCTTGACGGAATACGTCGTGACTCGTTGGTACCGAGCTCCAGAGCTGTTGCTTG
CGAGTCGTTACTCCACAGCCATTGACCTGTGGGCGGTCGGATGCATTCTTGCGGAGATGTTTACACGCAAGGCACTCTTCCCGGGCCACGACCACGTGCA
CCAGTTGCATTTGATTCTCCAGCTTGTCGGCAGTCCGTCGTCTGAGGACATGGGCTTTGTCACCAATATGAAGGCTAAGCGGTGGATGGCCCGACAAACA
CAGCATGAAGCCAAACCGCTCAGCAGTGTCTGTCCAAATGCACCGTCAGAGGCGTTGGATCTATTGACgcagttgttgcagttcGACCCGCGCAAACGCA
TCTCAGTGGACGATGCTATCGCCCACCCGTTCCTAGCGCCATGCCACGTTGACGGCGCTGAAGTGGGTTCTGAAGATCTGGCGCAAAGCGCTTTCGACTT
CTCCTTTGAGCGGGAGAACAGGGGCAGTATGGACAAGAATACACTGAGGCGTCTCATCTTTGAGGATATCTGTTACTTCCACCC