Description :
From Genome Similarity Track
Location :
scaffold_3:1281463- 1285102
Transcript NameFunction/comments
Plaha_PHALS_12887formin-homology 2 domain-containing protein

Sequence
3639 bases(100 bases per row)
CCTGATGATGCATTCAAGCGCGAGCCTCATTGTGGCGTGTGCACAAAATCGTTTAATATTCTACGTCGTCGTCATCACTGTCGTAGTTGTCACATTGCCG
TTTGCAAAGAGTGTGGAGGTAAAGCTATTGATCGTACGAAACCTGAACGTACGCGACCGCAGTGGTACTGTATGAGCTGCTTGGATGATAACGCCTCACT
CGATATAACTGGCTCACGCCCTCCTAGTGGCAAACGTCGCAGCTTTTCTACATCGTTTAGTGCCCCGACGAATGCACCGCAAGTCACAAATGTAAGTAAT
TTACATGATCACTTTGACGTGAAAAGGGATCACGTGTTTTTTATGTCTTGTTATAACGGGTGTATGTTTTGATTGACAGTTGACGAGTACAGCCAAGTTT
TGTATTGAATGTGGCTACGAATTGCCACCTCGAGTGAAATTTTGCATTGAGTGTGGCACATCAGTGCGTCCTCAGGTCATGTCACCTGTGAGTGTTGATA
GTGTGGGAACAGCAGAAGTGGATCGAGGAAATCGAGGCTTTCGAGATTCGTTGGGATCTAATCTTACGGTGATTGAAGAAAATAGTGGATCTCCTACAGA
ACCAACAGATGGATCAGATGATGGTATACCTGTGGATCACGGACTTGAAGATGCTGGgtatcaagaaaaaaacgtAAGTGACGAAAGTCTAGAGAATGAC
GATACGTGTAAAGCAAAAGAGTATGAAGAATTAGTCGCACAATTGCAAGTGGAGAATGAAAAATTACGGAGTCGCGTGGAAAAGTTTAAACGTAAGATTT
CAGAGGCTGAACGTCAACGAGTAGAAAGGGAGGAGGAGCATGCACGTGCTTTATCAGAAGCTGCAGCCGCAGCAGCAATGGCTTCTCCTGAAAGACTGAC
AGACATCCGCAGAATGTCGGAACCTCCACCATTGACTTCGACATCTGTCTCAGTGAAAAGTGACCCTACAAGCAACGGAATAGGTGTCGCTGCAAAAGAT
CATCCAGATTACAtgaaatatttcaaattGCTGTCCATGGGACTTCCTGCAGACCAAGTGAAGCTGAAAATGCAAGCTTCAGGTGTGGACTCGTCAGTTC
TGGATGACCCAAACGCAGTTATTGGAGGAAACCCAACCAGTAGCGCTTTAACTTCACAAGTTGAAAAGAATGGCGTTTTGGTTAAAGATGACGAGCAATA
TGCGAAGTTTTTCAAACTTTCGAAAATGGGAATGCCTTCAGAACagatcaaattgaaaatgaGCGCGAGTGGCCTGAATCCAGATCTGCTTGATACACCA
GATGCACTTTTGTCTGGATCGAATGGTAGTTCCTTATCTGCTGCGGATCCTAATCAGACAATGAGTGTGATGGACGATCCTGTATATCAAAAGTTCTTTA
AGCTGTTAAAGATGGGGATGCCGCATGCGCAAGTAAAGCTCAAGATGAGTGCCGCCGGTTTAAATGCAGATTTGCTTGACATGCCAGATGCACCATCTCC
GAATCAGAAAGCAGGCGGTAGTAATGGCGGTCTCTTGGCTGGACTTCCGCCTCCAGCGGCAGCCGTTAAAGTTGATACCTCGGCTTTACAAGCTAGCCTG
GCCTCGAAGGCTACACAAAAATCAGTACCTAACAATAAAGAAGAAAGCCAATTACCAAAGAAGGAAATTGTCAAGCCAAATGTCGAGCTAAGGCCGCTTT
TTTGGACCCGCGTGCCTGTCAACGTCGTGAGTAGAACTGTGTGGATGAAACTTAATGACTCGCATGCTGAGCTTGATGTGGATGAGATGGAGTGGATGTT
TCGCAAAAATCCCGTCGATACATCTAAAAAGCAAgacgagaagaagaaagacGCTGATAAGGTCGTTGCTCAGCCCAAGGAGGTGCTTTTGTTCGATCCA
AAGAGACAGCAAAATATTTCAATCGCTATCGCTCGATTTAAATTATCGTCAGAGGATATAAAGAAGTCAATCTATGCGCTGGATGGTCAAAAACTTGGCA
ATGAAGTGTTGAATGTATTAATATCAATTTCTCCAACACTGGAAGAGATTGACATGTTGAAAAACTATGACGGTGATGTTAAAATGTTAGGAAACGTCGA
GAGATTTTTTCTCGATTTGTTAACTATCCCACGGTATACTCAGCGAATTAAATGTTTCAGATTTAAGCTCCAGTTTGAGAATCGTATATTAGAAACACAG
GCGCAATTGGATACACTGGTCGCAGCTACCGAACAAGTGGCTGAGAGTGACAAATTTCGTCGCGTCTTGGAGCATATTTTGGCCATTGGAAACTATTTGA
ATGGTAGTACACCTCGTGGTGGTGCGTACGGTTTCAAGCTCGATACTTTGATGAAGCTGCACACGCTGAAGTCAATCGATCCTCGAGTCACATTGATGCA
CTTTTTGCTGCGTCAATTAGAAGAAAAAAACCCTGATGTTATCACTTTTGCCGGCGAAGTGCCTCATATCGTGGAGGCAAAGCGTCTGTCACTCGATCAA
TTACGTGCTGATCTATCGTCGTATAACACTGAGTTGGCTATGCTAAAGGGTCAAGTTCGTGCTTCTCAAAATGATCACATTGTTGGAGACAGGTTTTTTG
AGGTGATGACTCCATTTGCTAAGGACGCAGAAGAAGTTTTGGAAGAACTTGGACGCGATTTTAATGGTCTAGAGACTTTGTACCAGGAGCTTGTGACATC
CTTTGGCGAAGATCCACGGAAAGTTGGTCCTATAGAATTTTTTTCCATCTTGGACGAATTTGTGAAAGAGTTCAAGAAAGCATACCGTCAGAATCAAACA
AAGGAATATCAAGCCATTTATGAAGAGGCAGCAGAAGCTCGCGTTGCTGCAATGGCGGAAAAAGCTGAACGGTTAAAGCGGGAGGCTGAGGAGCTTCAGC
GATTAGAAGAAGAGCGACAGCAGAACTCGCACGAAACCAAGGCGATTTATGCTGAGATTATGTCCATCATCACAATTTGGGCTGGAAAGCATTCGCCAGG
GAACGAAGAGACACTAATTGAGCAGTTTAAAGACACTTCGCGAAAGTTTGGAACAAATGAGATAACAGGTGATGAATTTTGTGACAAGGTGCGACAGTTA
ATTGGATCGAAATGCGCCAGCAAAATCATATCCAATTCGGTAAATCTTATCCAAGACAAGACAAAGCAGAATGAATTGCTGGAAGCATTTGTGCGATTTA
AGGAACAAGTGAAGAGAGAAAAAGAGTTGAAAAAACAACAGCGCAATTCATTAGTATCTCCATCGTCTGGACGTGAAAGGGCAGGATCGTCTTCTGCTGG
TCGCAGACGAAAGGTAGTAATTCCACCTGCAATGAAAGACATTGAACCTGTTGTCGGAGAAGAGGCCCAGCTACTACATAAGTCGATTTTAGAGTCAGTC
TTGGCTGCATTTGGTGGAGAtacgaagaagatgaagtcgTTTACATCACATACTCGCAAGTATGGGAACGAGCAAATTACAGCGCACGAATTTTACCAAT
ATTTAATGGATTCATTTGACCCGGATTTTGTTGGACGTCTCGTGCCAGATCTTGCCCGATTATTGCAAGATGCAGAGAAACGGCATGCTTTGATTCGAGC
ATTGTGTGAGAGTGCACCGGGCTGGGCAAAGTTTGCGGG