Description :
From Genome Similarity Track
Location :
Scaffold_378:12813- 14702
Sequence
1889 bases(100 bases per row)
AGCGCTGAAACTACCCGATTTCACATCACCCAACTTCAGAGGCTTCTAGCCAAAAACCTAAAAAAGCCGTAATGACACTTTTGAAAAAATGTCCCTCATG
ATCTCTCTGTTGGAGCGATCATGTCGGTACACTATTTGTGCCGATTGCGTAAGACAGAGCCCAACGTACAACAACACGACTCCAAAATGTTAGGACAATC
AAGGCTCTACCTGTCAAAGGCGCATCATCGGACCCATTGCAAGAATTTGCATTGCAGCTTCAGGAGTATCTATCAACGGGAGCTCTGGAGATACTGGCTT
CACTTTCAGGGGTCAATAACAGCAGCAATGACATTAGCAGTTTGTTGGAGAACACCACCGACAACTTGTATCCGGGCAGTACCAGCAGCCACATATATAT
GGGGCGAAACAAGTAAAAGCCAGCGAACCATCATTATAGCTGTCAGTATAAAACGAATAACACGATGCCATGAGCAACTCAAGGTGTCAGCAAACTCCAA
AAGCGGTCAACCGTTGGCTAGGAGCGGTTCCGTCTAGGTCCAGTCTCCAAAATGGATCGTGTTCCCAGATCGTGTCCCTGCTACTAGGCCGTATGCACAA
GGTGCTAATCTTCTCAGAGACTGGCGAATGTTAGAGCAGCCTCGGGGtgtgcaggagctgcaagagtGGTTGGACGATGGTTGGGGACGCTGGGATAAGC
CGATGCCTACAAGGAGTTGGAGGCAACGGCGCCGAAATGAGGGAAAGTGCGTGCAGCGCAAGGCGTGGATGTCGAACGGCCAAATCAGTCACCTCCTTCG
ATCTACCATCGGTAATTCATTACAGCTGGTGAATATCCGAGGAGTAGAGAAGCATCCATGAGGGCTGTTATTTCCGGAAGCATGAGTATTCGAGGATGTC
CCAGGATCCAATGATGCAGCACAGCTGCACAAATTTAACGCAGGGGGGATCCAGACGACATTCGATTATCACTCCGCTCTGCTCAAGTTAACAAACCGAA
GATCAACCTCACCTCTGTGCAATATCTCCAAGATGGTGCCTCCTGTTCCTGGTGACGTTGCGTTTGTTAGGCCGACCGACCCATGTTGAAGGGCTTCCAG
ATTTTCAGTACGTTGAGCTCATACGACTCTACTGCCACGGTGAAGGTGATCGGGCCGGACGAAGAGTGAACCAGCAGGCAGCTGCCACTAGCCGTGGAAA
AGTTTTGTCACTGAGCTGTGCATTGGCGCGAACATGATCTGTGGCCTAGGACATTCGTCGCCCATTCAGTCGTGTTCACCTGGTCCTCAGTCGGAGGTGT
CAACGAAAGATCGTATGACGTCGTTTCCGGATACACTGTGTCTGAGCAGGTCACAGCACTGCATATTATATGCCAAGACATACCAGTGCGCATACCACTT
ACGACAACAACTATATTGATAAAGGCGGACGTGCTCAACTACGCACTTCAGAATGGTGCCCGTGTTAACACTGTAGCAGTCTGCCCTTCGGAGCTACTGG
AGCCACAAAAATTACGATGTGCCAACGTCACTGATTTGGTATCCCTAAAGCCGTTAAAGCGAAAATGTCGGTACAATCTCCGGGAACGATATCATTCCGT
TGATTCGGCCCGCAAACCTTGAGCTCGTGCGGGTTCGCCGCCAACACGCGGTCGACTACAAGACGGTATCTCGCTCGAAAGACCTGGTGGTTGGTATGTT
GACGCAGGAGCCAGATACTGTAGGTACTTGACCAGGGAATCTGCAGTCTCAATCCAGCGAGGAACAAAATGTATCGGACGTGTAAGGCCCCACGCCAGCG
ATAGCGAATCCGATGTGGATATCGCTGACTAGGAGATACCAGTGACGCCTGACTCAatcgactcggacgatgaAGGCCTTCAGGATGTG