Description :
From Genome Similarity Track
Location :
Scaffold_36:128107- 129124
Sequence
1017 bases(100 bases per row)
AGTAGCCCGTCCTCGCCGGCTTCGTACTCGTCGGCGATTTTGCTGCAAGTACGCGCCTCTCCAGCGCTTAACTTCTCCATATCCCCCAACAGGTACGTTT
TTAGGTCCGCGATCCACTTCTCTTCGTTCTGTGCTTTTCGGATTTGATCTGTTCTCATACGTTGTACGATGTCCAACTGTAGCAGTTCCGGAGGGCTCGC
GAGGCGTGTATGTAGGTTGTAGCAGCCGCTACACATACGCTCGGCGTCTGGTCTTTCGGGAGCAACAGTTCCGGCAGTCGGTTGAGAGCAATCAGGTCTT
CTCGGTTTATGTCCGAGGTAACTACGGTATATGCTTGTTCGCGTAGCCCGTCGCTTGCTAGCCAATCTGCGCTTTGATTCCATTCTCGCTTGACATGTAG
GAATTCGTGTGCCGGTCACGACCCCAGTCGATCTAGCGCCCGCTGTCGCAGAGGCGTCAAGCCGGGTGCCTTGCACTCGATCTCGCCTCGTATCTACCGG
ATCACTAGGTTGGAGTCGCCGCAAATAATCAGCCGTCCCCTGTCTTGGCTGGACAGTAAAACGAACGCCAACAGTAGCCCGTGGAACTCTGCCTCGTTTA
CCGTGAGGTCTAGTGCGTACTTCGCTTCTGCTGCGACCACAATCCAGTCAGGTAGCTTCCATACGATGGCGCTGCACACCTCTCCGCCGCGTTTGACACG
CTCCGATCCGTCGAACCTCACGACTAGCAACCCCTCGCCTTGATCAACCGTTGGCGGGGTTGCGGCGACATGTGAACGTGGCTGCTTCCTTGGAGCAATC
GACGACAAGATCGAGTCGACGTTCTCCCGAGAAGTGATACTTGCTGCAATGATGCCCAGAATTTCGTCCTCTCCGCGCGTACACTTGATAATTTCTAGCG
TCCACGGCGAAAGCAATGCCGCCCAGTTGCTTAGCCGGCTCTGCAAGCCCGATGATCGCACCAGCCATGCTAGCGTGGAGTATCGCGTCAGCACATTGAT
TGATCGCGTCACCAGCG