Description :
From Genome Similarity Track
Location :
Scaffold_444:12810- 13973
Sequence
1163 bases(100 bases per row)
CCATTCACGAAGAACGGCGTGTGCTTCATCGACGCGTGGACTAAATTGTCGATGGCAAACTTCACCATCGACAGGAATTCGCTCCAATTCGTAATGAAAT
GGACGTATCCTCGAAGGATCTCCTCGAGGACACGATTGTCGTGTTCTGTCTGACTATCTGTTTCAGGATGGTCAGGCGTGAACATCTTTAAGCGCGTTCC
GAGTGTTTTGAACACGGAACCTTAGAACTCAGCTGTGAACCGCGGTTCCCGATCGGACACGAGTTCACGAGGCAACCCGTGAAGGCGAAAGACCGTGTCG
ATAAAGACATGGGCACAAGCCGGTGCGTTGATTGATTCGGGTACAACCAGATGTACCATCTTGCTGAACCTGTCAACGAACACAAGAATACCATTATTCT
TGTGAGAGTCTGCGGGGAATCCAAAGCCAAAGTCCATTGAGACAGATTCCCAGCACTCGGCCGGGACGGGCAGAGGCTGCAACGGGGCTCAAAGGGAAGG
GCTAGATTTCACCCGTTGACAGACCTCACAGGCCCGAACGTACTTGCGCACGAACTGATACTGGCGGGGCCAGTAAAAGTCGCGGCTCACTGTGAGATAT
GTTTTCTCACGACCACGATGTCCGCCAACAGGTGCGTCGTGGTACTCATACATGATACGCAATCGCAGATCACCATGATCTGGTACGACGACACGAGGTG
TGTCGCCGGCAACAGCCGAATATTGGAGTAAGCCGTTGCGAACTGTATATATATCTGTAGAGGATCGATATACTGACGACAACTGCTTGAGGCTCTTCCC
GGATGGGTGCGAGAGATGATGCATTAATTGCACCATACCCGGATCATACGTATATCATATGTCTTCCAATAAGGTTGACTACGGGACACTCAAAGTCAGT
ACCGCGACAGTGGTCCGGCCAGTGTCGGGTAGCACAGCCGGCTCGAAATCGAGCTGGCGAGAGAGTGGGTCAGCGACAACATTAAGTCGTCCTGGCTTAC
ACTCGACGGAGAAATGATACTCCGCAAAGAATGACAGCCACCTCGCTATCCGCTGCGAGAGGTGTGGACTGTTTACGGCCGTGCGTAAAGACGCATGGTC
CGTATAAACTATGAAGGTTCTATCACCTAGATGATAGACTCTGAACTTAGCCAGCGCGTACTT