Description :
From Genome Similarity Track
Location :
Scaffold_627:1281- 4982
Transcript NameFunction/comments
Phymu_g11233hypothetical protein
Phymu_g11234conserved hypothetical protein

Sequence
3701 bases(100 bases per row)
CCTCCGCTGCCACCAGCGGCAGCAGAGCGACCTGTAACATCGTCATCGCCGCGATCCCCATCTTGGCGGCGCTCCTTCGACATTGAATAAACGATACATG
TATCGGATTTAACAGGATCGCATTTTGAGGCTGTGATTCCCCTGACCCTCACCCTTCCCTACCTTTTCTCCTCCAATCAATTCTCTCCAACTGTTTCGAA
ATGATATAATCAATTGAACTTCAGATTTGTATTAATTGCGAGCATAACAGCCGAGACAGCGGTTGGGGGCTTTTTCTCCCTTTTTCATATTCAAACGCAG
CCGCTGGTGAGCTCGAAGCGCGCGGCAACTCAACTCGAGCGGCAACTAGCAGAAGACACAGTCCTGCTGCAACTCGGACCAGTCAGCCTTTCAAACACGC
CATCGCCGCCAGctaccagcaacagctttcCAGGTACGCTTCACTACTTGTAAAAGCAGGAAATTGCAGCAGTCTAATTGCTGCCAGCTGGGACGAGCTT
TTTTATTGAGATTTCCTCACTTGACATTCACTCCTGTTGCCGCATCTCCCCCCTTGCTCAACACCTACCAGTAACAAGAAGCGCTCACGCGCGCCAATCC
GCCGCAGTTTAAATCTTGAAGTCATCAGAGAGAAAGCGAGAAGGCGCACGTCAAAGGCAACTTGGGACACTAGAGGTACCTAGCACAAAAggcaacaagc
agcaagtttTACACTTGGAGCTCAACTGAGCAGCAAAAATCAATTGTGTCTCTCACCCACTGACGGCGCAACTGTGTGCATCTGTAGACCTGCGCACACA
GAAGGCAAGGGATTAAGTGGTTTTCCACACCGAAGGCAACCACAAGCGTTAACCACAGCAACATCTTGTAGCCTCAGAACCCTATTTGGTTCGAGGACGG
CAACAGGACCAGGGCTTGTCGCGGTATATTTAGCGGCGGCTGGCTTGATCGTGTGTGTGGGCGAAACGGCGAGAGGGGAGAGAGAGAGTGAAAGAGACCA
GTGTCTCAACGCTTCAGAGCTGTGCAAGAACACAAGGCAATCACCGCCAGTGGCCAACGAGTAGGGGACACCACCAGGGTCTAGGTGACTGAAGCGGCAT
TATTCGAGCAGACGCCCACAACCCGAGCTGACACAGAACCGCCGCGGGAAGGGGCAAGCGAGTGACAAGCGACTTGAGGTGCGTCCCTCCTGCGGTTTAT
CCACTCAATGCCTCGATTTTTTTTCGCGTCTTTCAGACCGAAAATGCAACTTTGGCCAGCTAACTAactttctccttctctgtGCTTGGGCGGTTAATGT
TGCAGGCTTCAGACCCGCTATCCATCTACACCATGCCGCGAGCACCAGCAAAGGCAAGTACAGTCGCCGTGAGTGGCCAGCAAACGgcaacagctacagc
agcgcaggcgccgcagcagcagacagtGTCgcgcctgcagcagcttaaagaagaagcagagatgcagcagctacagctccagcaacttcagcagcaacaa
caacaccaacagcagtaccagctccaccaacaGGCGCATatgctgcaacagcaagcacagcttcagcagcaacagtctctCCAATATCCTCAAACCCTGG
GCACAGCGTCCGGAACGTTAGGGCAAAGCGCAACGGCTAACAACCTCGTGACGGCCGCTGTGCAAGCCGCCACAAATGCAGCGAGTGCTGCTaatgctgc
agctacagcaggAGGAGCCTCAGCGGGAGGGGGTTATGCGTTTCCGCGCAACTCGCCAGAATTTGCCTGTGAAAATGTCGGAGAACGTGTTAAGGGAAAG
CGACGGAAATACTGTCCGCACGAAGTCACTGCGCTCGTTTTGGGAGTGCAGCGGTACGCAGATGACAGTTGTCCGTGGAGCTCCATCCTCCGAGATCCCC
ATTTAGGACATTTGTTTCATGGACGGAGTGGAGTAGACTTGAAGGATAAGTGGAGGACACTGATCAAGACTCGACCTGAACTTGCAGCGTACACAGAGAA
CAGGAAGAATCACCGCAAGTATCGGCCCTTTTCAGCAACAGAAGAGCGAGCATTGTTGGAAGGTgtgaagaagtacaacgGCCAAAGAAATGTGTGGTCG
CTCATTCTCGTAGATAAAGAGCTGGGGCCGCAGTTTAATGACAGATCCAacgtgcagctgaaggacAAGTTTCGGACCATGAGGCGAGCAGGAGCCACAT
CCTCATTGCTGATTAATGGAGGTGGAACTGCTAGTCGGAGGACATCAGCTGAATCCACGCCAACGTCAGAGAGCTCTGTGGCCAcaggaacgacgacgac
tgcgaCCGCGGCAACTACCTCAAGAACAGTCACTCCTACTTCGACGGCAGCCTTGACGGCTGCAGTATCAGCAGCAGTCAATGGAACTAGCAGAGCGCAA
TCTGCTGTGACTTCAGCAAGCCAgcaggctgctgctcttttGGTGCAGAACAGCAACGCAGCGTCTGCCATGTTTGCAGACCCGAACTTGTACCTGGCTG
GGTCTTTTTCAATCCCATCGCACATTTCCCAGGGCATGAGCATGCAGCAAATGACAACGACGCAGTCTCGGCAACAGTCCGtacaagctcaagcccaagc
tcACGCGCAGgctcaagcacaagctcaGGCTCATGCCCAAGCCCAAGCGATTGCGAATGCTCAGGCTCGTGCCGCCCAggtgcagcttgaagcgcagATG
CAAATGCGAGCGCATGGTGGCCAGCAACAAGTGAATatcaagcagcagtatcAGGCGGTGAATCCGCACGGCGGTGCGTTTAGCGCGGGTATTCCAGGCT
ACCAGCTCGTCGGCAACCAGATCATTCCCCAGCAGTCACTTTACTACTCGATGGCGCAAAGCAATCagaaccagcaacaagcacaacttcagcagcaaca
gcagctccagcagcagattcaccAGCGGCAcctgcaacaccaacagcaacaacttgcCGCGGcgattgcagcagcttccaatagctctcagcagcagccg
aagtCGCAGTCAGCAGGCTCGAGCCAGCCAAGTGGTACATCCCGAGGTGCGTCAGATAGCCGCGGTCGTGGAGCGAATGCACAGTCTGACAAACACAATG
GTGCCAACAGTGTGAGTTTGggaggagcagcttcgtcccCTGTGGACGACCTGTTGATGCAGGGAGGAAGTGGTAGCGCATCTGTACGAGCAAATTCGTC
TTCAACGGGTACGTTTGGAGTTGCCTGAATGTTTTGTTCCCTTGATTGTCTATACTTACCGTACTATATTTTTTGCAGGCGAACACAGTACACGATCCAT
TTAGTGGAAGACTGACAGCAGACACTACtatagtttttttttttgccacACTTTGCCGGCGAAACATGAGCCCCGCTGGAGAGATAGCGTTTGCCTCATA
TATACGGAAACGCAGCACGGGCgacaagaaagaagaagggcaCGAGTTGTTGATAAAGTCATGTCGTACCATAGCGAAAGAAACAAGAACAACACAAGAC
AAAAACAAAAGAGATACCATCAACACCAGTAAAGTGTACCCATTTCAGCTTAACTTGCATGAGTGATGGTCTAGGTTCAACATGGTCAAGCGAGTGATGG
TCCTATAGTTGCCGTGGTTGCGGATGCAACGACGTCATTATAACTATTAGCGATCACTGCACAAGCGCATGTATCAGCCAGTACGCTTGCGGCTGCTAAC
A