Description :
From Genome Similarity Track
Location :
Scaffold_1165:1281- 3889
Transcript NameFunction/comments
Pytiw_DAOMBR242034snap_masked-piw_contig_1165-abinit-gene-0.11Conserved hypothetical protein
Pytiw_DAOMBR242034maker-piw_contig_1165-snap-gene-0.4Gene of unknown function

Sequence
2608 bases(100 bases per row)
GACATGGACAACGGGAAGACTCTGAGCGTGAGAGGGGACGAGACAATCCGGTACGCCGACGTCGTCTTGGGTACAACTGCCATGACCATGGTCGTCCATG
TCACCGGTGGGCGATCCTCCTGCGTCGGGCTTCCAATGACGGTGTTTATCAATCCCGACTGCAACTATCCGATTCGAGGTGTGCCAGACAACATCCCTGG
TGAGCAAGCTCTCGCTTTTTCTCAGGTCATTTTTTTAATCTGACTTGCACTGTACTCTTGGACGTGATATATGCAATTACACAGGTGTGGCGTATCGATC
ATCAAAGAAGGGCTTCATGACGTCGACGGTATTCTCACAGTGGCTTGCAAAAAGACGAGTGCACAGGAAGAAGTCCGGGCGGCGCAAAACCATGCTTTGG
CTCGACAACTACAGTGGGTATGCACAAGCAGACGCAGTGATCAAGCAGCTCCGCGAGCTCAACATCGAGCTCCGATACTTCCCGCCAAACTCGAAACATC
TACTCCAGTCTGCAGATCCGTTCGTGATTTCAAAAATCAAGGACGCGTGGCTCAAGAGGTGAGATGAAAAAAAGATCGACCAGATGGAAACAGCGAGTGA
CAGAACGAAGCTCACACCGGCGGCTCATGGTCCAACACTCTTCGCAATCATGGCAAGTCGTTTTTCCTGCAGCTGGGTGCAGATGCTGTCTGAGATGTGA
ACGCGCAGCGCACGAAGAAGAAGAACATAACCTACGCTCAGAAAGCTATGATGCGGTGCGGACTGGCATGCGACAGCGGTGTGGAGTACGAATCAACTCA
GTGAGGAGCTGCAACGTATCGTGGTTGAGCACAGCAGACACTTCTTATGCAAGCCTGTAGCAGTTTGTGCGGCTTCACACTTGTCTGGTGATCAAGAAGT
TTTTGTATAGGAATTCGTATGGGACTAACACTAATAGATGGTACAAAAAATAGTGTTAGTTTAATATTAGTGTTACTAACATCAATGCTGGTGAGCCAAA
CGAAATTCGAGTCACTCAAATAGTGTTAGTAACACTAAATACTGTGAGCAGTGTAGATTACTACGAATAGTCTATCTTTCTATCCACACAAATCTAGAAC
TGCCAAAGAAGTGAGTCAGGCTAGGTGGCAGTACGCTAAGTCCAATCAGCGGATGCCCCTTCTAGAATTAGGTTCGGCATGTAAAATGTCTAAAATCTCA
AATCTGGAGTCTAAGCAGCTCCAGGCGTACAGAGTCTAGTCGCATCACTAAAGTTTTGCTGCAATCGCACACTGGATGTCCAAAATGAAGAGCTCGTGTG
ACAGACAACTGTGTGTACAATTTGCAACAAATGGGTTCAGTGGACCGTCTGTGCAGCCTTTCGGAGTCATCTCATTTAACCGAGCCAGTTATCGGTGGCA
AATGGATACATTTGGCGGTCTGTGTACGTGTGTTAGTGAAATGTGAGTAGCGTAACCGCACTTCAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCTTTCACCGCAACTTGAGCATCGATGGGGCTTGCGCGCAATGTCACT
TGAAGCCAGAGTTGCCCCTTGACTCTAACGACGCAAGTGTTTTCGGGGTCGGCCTCCGCGCTTGTTGATTTTCGGTGGAGAACATTCACTCTTGGTAAGG
GAGCTGATCAAAACAGGCGGCAGTATCGTCTCACGGGAGCCTTGTGTGTAGCCATTCAGGTAGGTCGTGGTCTTTCACGTCTGTCGAAGTACAGGTGTAC
CTCCCCTTCTTCACCAACCGGTTGAAGACACCTAAGGGAATGATTGCAGGGTGCCTTCGTGTCGACTTCTTGAGCTCAGAGCTCAGGCAACTTTCTGGGT
CGGCTTCTGAGTCAGCAAACCCCACTTTTTCACAGACGCTCCACTCTTCACCCACTTCGCGCCGATATACCGTTCAATCGCCACGAGACTGTCCAGCGCT
GGAAGCTTGCGGATCCCACGTAGCACTCCATTAATCGACTCGACATTGCTCGAGGTGAGCGTGTCATAGCAAGGACACGGGCTGTAGAATGTTGAGCATT
TCTCCATCTGGATATCCATCAGCCAAGTCATCGCGCTCAAATTCATATTGGCGAGTCGTTCATCCATTTTCTCGAATTCAAACTTGGTCACTGCTCTTGC
CAACGCCCACGCTGCGTTCTTCAGCTCGTTCGACTTGAACTTGCGGTTGAAGTTTTCCATGAGGTGGCAGAAGCAGAAGAAGTGATGAGGAGCCGTGTCC
GGAGACGAGACGGCAGGAACGAGGCCTTTGTCACGATCGGAGATGGGGAAGTGTGGAAGCTCCAGTAGATTCCTTGTCAGGAATTGCAGAAAAAAGTCCC
AGTTGACC