Description :
From Genome Similarity Track
Location :
Scaffold_2949:1281- 2557
Transcript NameFunction/comments
Phyta_totarag14962hypothetical protein

Sequence
1276 bases(100 bases per row)
GTAGTCAACTTTGCGTAGACCCCAGAAACTCTTGGCAACACTGATCGATAGGTTNGAGGTAATAAACGCCGAGATCGCGCGCGCTCGATCAGTCATAGAG
ACCACCCAAAATCCACTCGCCAGGTCCAGGGAGCAATACCAGAGGACCTTGTCAAGATCGTTGATAAGAGGCCATTAGTCGGGTCAGACTGTTGATCAGG
CGATAGTCGATACAGAGTCTAATGTCGACTCcattcttcttgacgatcACGACGATCGGGGACGCCcatggcgacgtcgagtgTCGGATGATCTCGGCCG
ACAGTAAACCCTTGATCAGCAGGAACAACTTCTCGCGGAATTGCGGAGCGACCTTGCGGATCCGTTGAACTATCGGTCTTGCGTTTCCCACTTCAATGTA
ACAGATCGCTCCCTTCGCAGCAGGTGGCAAGGCGTTCCCCTTCCCAATTAGAAGGTGTCGGCGACGCCGTATGATCTTCACTAGtcgctcgatctcttcc
gGCGTACTGTCCTCAAGGTTCCCAACTTGGATATCTTCGGTCTTGACTTCTTCCGTCGTCAATGTGATCTCCGGCAATACTGCCATGTGACCCTCGAGAT
CTTCTGCGTATAGCTCCCCTCCTTATTTGATGTACACCTGTTCGTCTTCCGCATGTTCTTCTGCGTAATCATCAGCGAGATCTTGTTAATTCTCGTCCGG
GTCTTGTTTCTCGTCCGGGTCCTGTCTTAGTGTCTCAGATTTTTCTCCAATCCCTGCAGATCGATCTAGAATGCATTTCTGATTTTCACCCATCTGTaca
cctcgatcttggcaATCACTTGAATGCTGACGTCTGCAATCTTTTGCATACATCACCCTTTCTGCACCTGGGACTGGGCACTTTGTACACTCATCGATGT
TGACGTGTACCTTCCCGGCCGACGATAGACACGCGTTTCTTCCGCCGTTGGGGCGCCTTCTCGCAAAATCCCGGCAGTGttctccgccgtcgccactGCC
GAGCACTGCCACTTTTGGCGGTCGCTCCGGCAGCCGGGGCAAGATCATAGTCGGAGTCTTGTACTGTGGCTGATCCACGGCGGGCCCCTGTGGTTCCTCA
AGTTCCTGGCGATCTTCACCGATATCCACCGTCGCCTGGTAGGCCAGGTTCTGCCATTCAGCATACCTGCGCGATCCCACCGAGACATAACCAGGTAAGC
GGAGTACCCGATCTCCGGCCAGCCACATTCCGACGCGCATGTTGCGATCCAGTACTAACTTGCGATCGCTCACGTT