Description :
From Genome Similarity Track
Location :
contig_3:1280749- 1285380
Transcript NameFunction/comments
g1169.t1hypothetical protein
g1170.t1RAW25124.1 hypothetical protein PC110_g18456 [Phytophthora cactorum

Sequence
4631 bases(100 bases per row)
CGCAGCAAGTTACCGGCCAACCAAACGTCAACTAGCTTGCAGCATGGCTCCGACTGCTGGTATGTCTTGCTGCGTGTGTGTACCTACCCACCTCCGCTGC
AATAACGTCTAACATCCCTACGCTTCCCTCTCGACCGCAGGCACCCGTCTCCGCTTCAAGAACTCGCAGCCCAAGAAAACGCAGCAGACCAAGAAGGTTC
CGTCGCTCAAGAATCGCATCCGAGGACTCGAGCGGTTCCTCAGTCGCGGGGTGCGTTGGCTGCAATTGCGAGTGTGGAGCGTTGCATCATTTGTATTGTT
TCTAATATTTTGCGTTATTGGTGATGGTGGTGCAGGGGCTGGCTGATGCTACGCGGAGAGCCAAAAAGGCGGAGCTCCAGCAGCTCAAGGAAGAGGTTCG
TGCACTTCGCATCATAATATTTGTAGTTATGCAAATAAAACTAAAGTTGTGGTTTGTTGATGGTTGGGTAACAGCACGAGCAGAAGGGAAAGGTCGCAGA
GGAGAAAAAGAATGCCGAGAAGTACAAGAGGGTGAGTGCACGCAGCCAACATTGCTACGTAGCAACACTCGGGGCGTTTTGATGAGGTGATGTCTGACTT
GGAGCTGGTGTTGATTATGTCCTAGCCGCGCTTTTTCGAGCGTGTGAAGGTGATGCGGAAACTGCGTCAGGCTAAAAACCGCCTTGAGCAGGTGAGGAAA
TTTGTTGATCACAGAGTCGCAAATATGGGCTGAGTACGACTCTAATATTTGTTCTGGTCGTAGGCAACGGATAAGGCCGAGCGTAGTGAGCACGAAAAGA
AATTCCAGACGTACCGCGAGGAGATGATGTACATCTACTACTACCCGACGAGCGAGCCTTACATTTCACTGTTCCCGTCGACACCTCACTCGGAGAAGAA
CCAGAAGCGCCAGAAGGAGATTCGTGTTGAGGCGATCGCCCGTTTCGAGGAGGAGCAGCCTACTCAAGAATTCCACCACTTTTGCTTCAAGACGAAAGAT
TCTGCCTCTGCAGGTGAAGCTAGACCGGTTGTGGAGCTTCTGCTGAAGAAGCCCAGTAAGGAAATGGTGAAGAAGCAGAAGAAGGCCCGCAGCAAACGTG
ACAAGTCAGGTGAAAAGCCGAAGCACACTCCAGCTCTAGTTGACCAAGATGACGATGATGAGGTGCCGGATGCATCCAAGTCGGAGAATGAAAAGGAAGA
GGAACTGGAGGAGGAACAGGAAGAGGACGACTTCTTCTTGTAAGTGTCGGTACAGAATATAGTTGCAACGAGTCGGGTCGTTGCTGTTCACATCTGTGCA
GACAACCGTACGTTCAAGGTTTTCGTTCTTGCGATTTATTACTTCAAAGTACTAATAGTCTTTACGCTGACGAGCTCATAAGGAGGAGGAGGAGGAAGAC
AACTTGGACACGAGAAGTCTGTAGAAAAATATGAGGAGGAAGCATCGGACGATCTCGAAATTCAGCTAAATCAGAATAGACGGAGCGCCCGCCGTGCTTG
CGGTTTGCTGCTCTGTGTCAGTGATCATGTCTGCTTCAGCTTGCGATGCAGCCGCCAATGCGTTCATGTTGGTGAAGCTGAAAGACCTGAATGCATCTGA
GAGGTTGGAATCTTCGGGACTACCGTACATTCCACTTGGGAACCGATAGTGACTATTGTTGTCTTCCATCGGCAGTCCGTCGCCCATGTATTCGTCATGA
GTAGCATCCACTGTGTCAAGTGCATTTAGCGCTCCTGCGGTCCCCCACGACATGTCGACATCCGCTGTACCTGCAGAAGTACAGCTTGCGTTGTTGTCAC
CACTGTCACAATCATCTTCTCTTTTCGGGTCAGACGAACTCAGTGGCTGATCGTCATTCTCAGGCCCAGAGTCGATGTTGTTCTGGCTGCTACTGGCGGA
ACGGGAATCGACATCAAATTCGTCGTCGTCGATGAATATATCCGTGAGATTACGGTTGTTGAAATAGCTGGTGTCGTTCGGCCCTTCCAGTGTCGGTACG
AACGGAGGTACAGATTCCAGGATCGTATCCCAATTGATACCATCGAAAAATGGGTGCAGTTTGATCCCCTCCCAACCCATACGGGCTGCCGGGTTCGGGT
CGAGTAGCTTGTCTATCAGGTCCACCGCCTCGAGCGACAAGCACTTCTCTCCATCGGGCCACAGAATTTGCCGCTCGAAAATATTCCCGAAGATCGCTTC
CACAGTGTCATCATTGAACGGAGGAAAACCAACCAGCATTTCATAAAGGATAATTCCAAGAGCCCAGTAATCCACGGGAGGGCCGTGAGGGACCCTACGA
ATGATTTCAGGCGCCAGGTAGTCCGGAGTACCACACCGTCCATACGTCTGATATGCAGACTTATTTTTCAAACTCCTTTTCGCTGATGAGGCGTGGCGTG
GACGGCTATGTGCTGGAGCAGACGGCGTGACTCCCAGTGGAGTGTCGGGTAATATATCCGAATCCTGGGCCATGGACTCATCGTCAGGTTCCGAATCCGA
GTCACCAATTGTCACGGCTTCCTCGGACAAACCGAAGTCGGTCAGCTAAAATGTGGGAAGAGAATTCCAGTAGCGATTAGAGGTGAAACGATAGAGACGA
GAAACTGTATACAAGTACTAGTAGCTGCTAACCGCACCTTAATGTGTCCGGTTGACGAGAGCAAAATGTTATCGGGCTTCAGGTCTCTGCATCATCATAT
GCCAAAAACCAGGCAAGTGGATAGACAGACACATGAGTGATCGATCTATGATAGCGTGCAATAGCTGCGAATTGAACTGTCCAAACCTGTGGACGCAGCC
TTTAGTGTGCAGGTGATTGAGCGCGATTGCGATCTCCGCAATGTAGACGCATGCCACCTGATCAGGGGTAAATCATAGTTCGTTAGCATCATTGATCGTA
CTTTTTGCAACATGCACACAAGCTCACCTGCTCTTCCAACTGCACAATGCACTCCAACAAGGACATGAAATCTCCACCGGGAAGATATTCCATCACGAGA
AAAAGGTTGCGCCTAGCGATGTCACCAAAAATAATATCAGGTATGAGCTACGCGGGTACTATGAGCTTAGTGCTGCATGTACTGCTTACTTGGTTTGAAA
CGTCCAGAATAATTTCACGACGAATGGACTCACGACGCTGGCGAGTATGTTCCTCTCTGTTTCGATCTGCTGAATCTGTTGGTGGCACACAAAGCGAGCA
ACAGAGCAAAATGCTCAGTAGGCAGCCCTGTGATAGCAACCATCCCAGGCTGCAGGCAATGCGCTGTACCTGCTTTTTGCGCAGCAAGTGCTCTTTCGCG
AGCACCTTGATCGCATACTGATCACCAGTTGTCTTCTTCCGGGCGAGATATACTTTACCGAAAGCACCTTTCGAAATAGGCTTAACAATCTGGAAATCAC
GGATCGAGACACGATAGGAGGCTGGCTTCAGACTCGCCCGGCGCGGTGCTCGAAAGCCATCGCTGCTTTCGATATTCTCCAGGGACTTGGTGCGTTTTAG
CGGCGTTCGCACTACCTCGACGGGGGCTTGCTGGAACATCACCTTCTGAGATGCTCGCATTTTGCTCATTTTGGCGTGGATCAAGTTGCGCAGCTTGGTG
CAGTATTTGATCCCGCGTTCGACGGCAAAGTTGGGTGTCTCGATCTCCTGTTGTCGTATTCTATCGATAATTTTCACTAGACGTGCACACAACGCAAACG
CGTCGACACTAGTCACATCACAAGTCGAAGCCTGGATCGCCACTACACGCAGTGCGTGGTAGATGTGCATTTCCTCCTGGTCGAACATGGGTCGCATGGC
CTGCGCGCTCAGCGTGGCGTTAATCGAGGCCGTGAGCTTCACCAGCGAGTTGTTAATCACATCCGCTTCCAGCTCCACCCTCTTGGACAGTACGCAAAAA
TTGGTATGTTCGTCCAAGCTGTTGGCGTCCACTTTCGTCTCGCAGAGCTTGCACACGACCACGGACTTGTTGGCGCGGTGGAACGTGACCGTCATGGGTC
GTTTACTGAACTGCAGGTTGTCCAGCACGTCTTCGGGGGACGTGGCGGCCATGTCCCGTCCATTGATGGCGTCCACCATGAGTCCCCTCGTGATGGTCAC
TCCCGGGGGAATGTGCATGACCACCGTCGTCCACGTCTCGAGGTGGACGCTCTTGATCACGACCTTGTTCTTCTGGGTGTCAAACACAAACTCGAGCCCC
AAAAAGCCGTCCCCGAACGTCACGTCAAAGGTCTCACCCCTCGGGACGTCCTCAAACAGGTCTCCTCCGTCCTCGAGCATGGCCACGCCCTGGTCGTCGT
CCTGGTTGCCGTCGCTAGATGCGAAGCGGCGCCACTTGACCTGGTTCTTCTCCCAGCGGTTCAGCACGTCCTCCAGCACGTCCGGAGTGGCGTCCAGCAG
CCCACTGCGACTCATGGAGGCCCCGCCGCCGCTGAAGGGCGGCACGTTGAGCGTGTACTGGCGCTGCAGCCGCTGGGGCTGGATCTCGAGACGTAGCTCC
TCATGGATCCGCTCCATGTCGCTGCTGCTGGTGCTGCTGGCGCTCGGGCGGCGCCCGCTGCTGTCCGTGGGGAGCTGCAGCTCGGCCACGCGGGCCAGGG
CGAGCTGCTGCAGCCGCTCGGCCATGAGGAA