Description :
From Genome Similarity Track
Location :
Scaffold_85:128042- 130743
Sequence
2701 bases(100 bases per row)
GTACCGCTTAAGACGTCCAGCATAGAACATCGGGTGCGTCGTCATTGACGTTGGCAGGTCGATAGTGTACGACGCACCATGTCTGGCCAGGACTGCAAAC
GGTCCGATGAAGCGGTACTTCAGCTTGCTGCTGCCGACAGAGCTGACAGTGTCAAGAGGTAGGATCCTCGTGTCTAGCAACACTAAGTCCCCAACCTCAA
ATATACTTAAGTTTCCTCTTCCATGTTTGTCTGAGTACTCCTTTTGTTTATCTTGGGCCGCTGCCATGGCATCGCGGACCCTGCTGACAATGCTCAGCTT
GGTATCCATAAAGGATTCCACCTGTTTCCGCAGCAAAACTGGTCTCACATCCGAGACCTGGGAGGAAAGGGCTTTCCGAGCCTCTCCCCCACTTAGAATG
GAGGGGTCCGTGTCTCCTCGAAGAGTGAGAGGCACTCTGGGGTGGCGGAAGCCGTTTAAGTAGAACGGCGTGAACCCCGTGGACGCGTGCACCACGTTGT
TGAGCGCAAACTCAACAACTGAAAGCTGCGTCGACCACGTACGTGGTGCTGCCGCGCACACACTGCGCAGAGTGTCCTCGAGCACTCGATTGACGCGCTC
TGTTCGGCCGTCTGTCTGTGGATGGTCCGCAGTGGACATCTGCAGACGAGTTCCCAGTAAAGGGGACAGCGTTTTCCAAAACGCAGCAGTGAAGCACGGG
TCTCGGTCCGAGACAATCGTCTCCGGTAGACCGTGATAGCGGAATACGCCATCGACGAACAACCTTGCGGTTTGTTCGCACGTAACAGTAACGGGAACTA
AGCAAGATGTACCATCTTGCTCAGCCGACACACGAACACCAAAATTCCGGTGTTGCCGTGTCCGTCGGCGGGAAGCCCAAAGATGAAGTCAAGACTCATC
GACTTCCAACAGTCAGCCGGTACGGGCAGGCTCTGTAGTGGAGCCGAAGAGTGCCCTGCGGGTTTGACCCGCTGACATGTTTCACATGTCTTGACGTACC
GGGCCACTCACTTGTACATGTGGGTCCACCAAAAGGACTGAGAGACCGACAGAAAGGTCTTCTCGCGGCCCAAGTGGCCGCTGGAGAGCGCGTCATGCGC
CTCCGCTAGGATGTCGAACTTCAGATCCTCGTCGTTGGGTACGACCACCCGTGGAGGATCAGTGGGCTCCACCCGATAATAGAGGAGGCCCTCCTTCAAC
TCATATCGGTGGAGCCGTGAGCGCTGTCGCGATGAGAGCCAGTCGGACTTCGCGCTCGTTCCTGCAATAAGGAACTTGACGATAGGCGCGACAGCCTCAT
TGTCCCGATACGCCATGCGTATTCGATCATATAGATCCCTTGTCATCCGTGTGATGTGGGCCAACTCGTAGTCAGGACGCCGAGGGCGTCCGCAAGCACG
TTGAGCTTGCCCGGCTTGTATTCGACGCGGAAGCTATATTCCGTGAAGAAGGACAGCCACCTCGCCATCCTTTGGGAGAGGTGAGGCGAGTTAGTCGCCG
TCCTCAAGGACGCGTGGTCTGTGTAGATCACAAAGGGCCTAGAGTCCAGAAGGTGAACACGGAACTTCACAAGGACATATTTCATTGCTAGGAGCTCCTT
GTCGTGGACAGGGTAGTTCCGCTCGGTGGCTTTGAGCTGCCTGGACTGGAACGAGATGACTCGTTCGTGTCCGGGCCGTGTCGGCCTGCAGCAGTGCACA
CCCGATGGCGTAATTGGACGCATCGCAGACGACGCTAAACGGCTTCGTCTAGTCCGGCAGGGCCAGGACAGGGGCCTCTTGGAGACTGGCCTTGATGCTG
TCAAAGGCATTTCAATGATCTTGCTCCCAGTGCCAGTCGACGTCCTTCTGAAGGAGGCCTGACAAGGGCTTAGTGAAGCCCGCGTACCCTGCACTATACT
TGTGAAGGTAATTGGCCAAGCCCAGCCAGTTTCGAAGATCCTTCTGAGATCGGGGTGTCGGCCATGCTGCTATGGCCATGACCTTGTCTGGGTCGGCCCG
AACGCCCACGTTGCTTACGAAGCAACCGAGAACTTTAATCTCTGGTGACGCGAAAACGCACTTGTCGATGTTGGCGTAGAGCTTGTTCGCTCGCATTACG
TCCAACACTCGACGGAGGTGTCCTAGATGCACCTCCATGGCCGTCTTGCCTCCCTCGGCACGGATATGGACGAATATGCCGTCGAAGTACGTCTGTACGA
AGGTACGCAAAGAGCGGAACAATTGCGTCACCAGGCGATTGAACGTCACCGGGGCGTTAGACAAGCCCTGTGGCATGATGAGCCACTCCCAAAGTATGCC
GCTTGGAGTGCTTACCGCGGTGAGCGGGATGTCGCTCTCTCGCATCAGGATTTGGTAGTATCCGTCTACCAAATCCTGCGCACTGTGCAGTACGCTCCCG
GCGATGTTGTTTAAGAACACATCCTTTCGTGGGATTGGTGTTTGGGCCGGCACCGTTGCGTTGTTCAGCTTGTTATAAGCGTGAACCAGACGCCACTTTC
CGTTCGGCTTCCGAACGCAGAAAGTCGGCGTAGAGGGTGTCGATTTCGATTCCCGCACCATGCATGCCTTCGCTTTTGCGGCGAAGAAGGCATCAATGAC
CTCGCACTGTTCGCGCGGGAGTGGCCATTGCCTCGTGACACAATACTTTGTGCCGGGCACGAGATCAATCTCGTGCCGTACGCCTCGATCCGGTGGGAGT
T