Description :
From Genome Similarity Track
Location :
Scaffold_1274:1280- 4246
Sequence
2966 bases(100 bases per row)
GTCAGGCACTTCTCTTCGTCCGTAGTCTGATTTCGCAGGAACGCCGACTTTACCTTGCTGATCCACGATCGGCCGCGGTCTTCGTCCTGATCCTTGCCAT
TGAACTCCTTAAGATCGGACATCGCCGAAATCCGCCCACGCTGGATCAATGAGGACCCAGTGGATCCTGAGGCAGCGGTGGCCACCGCAGCAGGGGCTGA
ACTCGGTAGATCAATGTCGTCCGGATTGTATTCCTACTGAGAGAGATCTTGATCCAGCGATCCGGCTGATTCCATCTCCACGTCCCGCGAAGACTCCAGT
TTGCCAGTCGACTCATCTGATCCGGTAGTACTGGTGGTCCGATCGGTCGACTTGGGTTTCTGCTTCCGAGGTCCTGATCGCATGCGTTCCTGACGTTGAC
TCCGTCATCGTGCGTCCAACATCGCAGATCCTGAAGGGCCGAGGGACATCCGTTGAGGTTCAGACGACGTATCCGATACGTATTCCGCTGCGGAGACATA
AGGAGACGACGATCGGTACCCAGTGGACTCCATCCGCGGCGACGACGCGGGAGCTGGCGACACTAGATCTGGCACCTTCGGGTCCGGACTGTCCGCGATC
ACGTCGACCAAAGGTCTCAACTTGTCGACCAATGTCTGGATCGCTGTCTGGATCACATCGAGATCCTGATCGAAAAGATCATTCGCTTCAAAGGCGCCAG
CCACGAAGCCGGCTTCCTTCAACAGTCCGAGCAGGTTCTTCACCGCCATCAGCTTGTTGTCCGCCACTCGGGGGGCCGAGATCGGGCCCTTCGGGTCGTC
GATCTGCTCTGGCCGCAAGATCACCATGACGGGATCTTGACGCAAGAAGTCTCGCAGTTCCTTCAAGTGATACTGACGATCCAGGTCAGCCTCGGACCAG
TCGAGCGCCGACGGTCTGGGATTTTCGTCGTCCAGGCCTGGCGCTCTCAGCTTCTTCCTCACAATCTGGTCCTTGTCCGCGATCGCGTCCAGGTAGTCCG
GATCGAGCCTGATCGGCGAGTCGGCGAACGCGTATCGGTCTGATCCCGCCTTAGTTTGTTTTGTTAGTGAATCTCGGTTCGCACCAAGATCCACCGGGGT
CCCCGAAGGGACCTGTGGAGGATGTTGAGGTTTGTCTTCTAGATCTGTCTCCAGATCGCCCTCGATTCCGTCGACAGAAGTCCTCCGAGCACTCTGTCGA
TCCGCGGATCTCGTTTTGTTCAGCAGCGTCTTCGTTGATCCGATATCCGACGACGCCTCTTCCCCTGGTTCTTTCTTCACTTGCGCATCTTCTACGGACT
CACGGTGAAATCCCTGGTTCGAATCCGGGCACGCACACCATTGTGGTGTAGCGGGATCGGCCAAAATCTGGTTAAGGCCTGATCGAGCTTCCCACCAGCG
CCCAGACACCGACTAACGGAGGGGGGTCCCCCAACGATCCGTGATCGGCTGAACTTGTTCTCACCTTGTGTACCCGTCGGCGGGCTGGATATGCTCTCTC
GGGGCTCCGAAGATGCAGAACTTGGTGAAGATCGAGTGTCTTGGCGTGACGCGGGGATAGTTTGTGGGGCAGCGCGGTAGTCTTCGCTCTGCGTCCGAGT
ATACGCTCCGATCGAGGGTTGTTCGCTCCGATCGGTCGGCCTGGAGTTGATCCAAGGCCTGTAGTCGCTTTTCCGGGTGTGTTCCTTCCTTTCCTGAGTT
GCTTGCCGCTTCCTATAGCGGGATCGAGGTTGATCGAGAGGAGAAACGATCGCCGGTCAAGCACTAATATCCGGTCGATCGAGGACTTGCACACAAGAGA
TAGATCACTAGAGTAGGTCAAGCTGGCCAATGAATTAATCCAGTCTTAACCGTACCGCTAGTTCACTACCCAAAGTGTCGACCCTGCCGAGGCCAATGTA
GTTCCTGGGACTTGGTGACTTGAGGGGACTTGTGCTCTTCGGTGCAATTTCTGCTCGAGAGCGACTTGCCGGGGCTTGGTGGTCTTGGATCACGCGTGGG
GTCAAATCTGTTCTCCACAACGCAAGTCGATCGAGGCCAATATGCTCTTCCTCCTCGAGATTCCAGACCACTTGCGCTCCACGGTGCAAATTCGACTCTG
ATTTATGTTTAGCTGGTCTCTCCCTAATGCTACCATCTTGCTTACCCTCCTACAACCACACGATTACTGGATTCTTGCCCCGACTTCGTCCTTCATGTGC
GTCCCATCCTGGTCGATCCACGATCGGCCCCGATCGGCGATCGACTCCGATCGGCCCTGATCGGCGATCGACGATCGACTCCCGTCGGCCCTGATCGGCG
ATCGACCCCGATCGGCGACCCACGATCGGCTCCCGATCCACGATCGACCTCGATCGGCGATCGGCGATCCACTCCCGATCGATGACTTATGCCGGTTGCC
ATGCGCCGCCGATCTATCACCTTCTGTCCTCGGCCATCTCAGATCCGCGGGTTCTGTCGTCGATCTGGACTTGGGTCAGCCACGAATCACGCCGCGGTTC
GGGCACGATCACCCACAATCCGGCTTGCCACATGTCCTGCCTTACGCGCCGGCGTCATCGGACCACCTGAGGTCTCCCGAAGAACTCCTTCCGATCCGTA
GATCCTTGCTGCCAGTCTCTCGATCGCCGATCTCCCACGCCTCCAGTCGATCGGCCCAGCCGCCTTTCTCGGAGAACAATTCTTATTCAGCACTTCTCCA
CACCTACCCAAGACAAGCCCATGCCGAGACTTGCAGGCATGCACCAAAAGGTATGGGTCTGTGAGCGTCTAATACACGAGCGGCGCTATGGTCACATTAC
TGGTTATGATAATGCGCGGTCCACCTCCCGCTAATTTTCAGAAATTTGCATTAGGTTGAAGCGCTAAAATGTGGTGCTCATGTTGCACTTTCAAACGTAA
AACCACGCGTGACACCCAATCGAGGCGCGAAAGCGTTCGCGCGCGAGAATCGACCTACCACGCACG