Description :
From Genome Similarity Track
Location :
Scaffold_117:1280- 3005
Sequence
1725 bases(100 bases per row)
TGCTACAGATTTACGAACTACTATACCACAATAAACAGATAGCCATCGAGATTGTGTGTTATGCATACCGTATCGCCAACATTGGTCATCCTCGCAAGGC
AATCAAGGGATTCCGGGGTACTGGACTCTACCCTCTCTTTCTGGTTCAATTACACAAGCGTCTCGGTGAGTATCAAGCTGGGGGACTGAAAGGCGACTAT
GGCAATACATCCTGGCTTGTCACCGCCCGAATGTGGTCACCACAGTCCAGAATATGATCGCCACGCTCCCTCCAGAGCCTGTACGGAAGCAGAAGAAGCG
TAGAACAACGATAGACATCGCATGCAGGTTGGTTACCAAATAAATGCTTGTAGAAGCATCCGGCCAGTAGTCGTGCACGAAACCGGTACCGAGTAAAATG
GGCTTATAATTGACTGATTTTTATAACTCGTAAAACTTTGTACAATAATGTTATCAATGTGCAACTATATGGATTAAAACCGCATCTAAAATGGCTGTAA
TATGATCTTGTCAGATATATCCGATTCGTATCATTTAAGTAAGCTAAATAAAATCTCTGAATTGGTCCAAAATCGTGCCCCGAACTGGTTGTTTACCTTA
CCACAACTGGCGGCTGGGTCGTTGACCAGGAAAGGAGTGTCCGCTATGACAACTACATTCCCAACACTATTTAGATGAAGAATCAATCGTTCGATGGATG
GATTGACTGATTGAATATAGTAATAGGGTTGCGCGGGCGAGGTGTTTGGCTGTATGTGACCTAGCTATCATGACTTGCTCCACTATACTGCATTTGATTG
CATTTGAATGCATTTGATTGCATTTGAATGCATTTGAGGCCCAAGATTTTGTTTTTGAACTAGTTGCGGTTTTAGAAGGAGCGTGTGAAGGAATGAAATG
CTAGGACATAGCATAGAGGCTTTGGTCCTCTTGACATTAAACTACCCCTTGCTACCTGTTACTATCCAATGTCGATCGGGTTCAATAAGCGTTTGTACAA
AAGCGTACTCGCAAGGACGAATAGTCTACGGCAAGCGACGTCGTGTGTCGTCTCACTTGGGCACCTGAAGGTACGTCTATGCCCCTTCTCTCCAGCTACG
CAACGAAGAGTTCGACTTTGACGTGACATAAAGAAAAATATGCGGTGCCCTATGCCACTTCAACGTAATCATGACCTCACAAGTGAAGTGGTGCAGCCAT
TCCGAGCTTATCCAGCTGAGACCGTGACATCATCTTAAAAGTTGCAAAAATATATTCCTCCATTTCCGGCAACTGAGGCAGAAGCAGGTGCTGCTCCTGC
TCTGATGCAAACGAGCGGTGTAGATCTAGCAAGTGGCGCTTATCCGCCCCACAGGCTTACATTTGCACTGTTGTCGTGGTATGGTCCACTACTGTGAAAT
CTTCTTTGGAGACAATCAAGTACTTGGTGTTGCGCTCGCACGATCCGCTTGGAACCAAGTTCTGCTGCGGATTTGTACAGGCACAGTCACAGAGGCAACG
ACATCAGCTTCTGGTTTGGGCCTGTCAAAGACGGTTTTTGCCTTTCCACGCCGCGATCGGCTGATGTGACCTCTAACCCCCAAATCAGAGCTGATTGTGT
ACACACTTGGCCCACAAACCTCCAATTGTAACGAGCCCTCGAAAATGCTGACGATAAATGAAGAACCTGCAGTTGTGTCATCAACTACGATAGTGCTCTA
GACATCACGAATCAAGAGAACATAC