Description :
From Genome Similarity Track
Location :
Scaffold_2576:128- 2886
Sequence
2758 bases(100 bases per row)
TCTTGCTCCATGCTGCGAGCCCCGCTCATTCCTATGAGCCGGCTGCACCAGCCCACTAGTCGAAGCTTGAGCTCAGCCACCGACCTGTCATCCCCCGCGT
TCTAGCGGCGGGAAGCGCTCGGCGCCTGACGACGCGGTCGTACGCCGTAGCGGCGGGGCAGTGAGTGTGCCCGATCAAAAGCGTCGACGACGTCAGGGCA
GTCCTGCCGGAGGACAACCTCAAACTCCCAAGAGTTTTGTGAGTGAGGATAACCCCTCCATTTCACAAGGTACTGAGTACGACCCTGGCGCATGCGCCTC
GCCATCAGGCGTTCCACATGGAAGTGGAGCTCGCCGTGCTCATCGAGCAGAGCAGGAGGAGGCCGAGTCTCAGCTGGACTCTCGCGTCGCGAGTCGCAGC
GACGTGTTCGCGCTGGAGCAGCGTGTGGGTTCCCTGAACCGGTATCTCCATGATACGACTGACTCTCTGAGTCGCCTTGCAGATGGTCTCGATGAGACGA
ACCACCGCGTGGACTGGTTTGAACAACCACAGTCGGTTCAGAACCGAGTCGCGGACCTTGAGCGTCAAGTCGCTCAGCTGCAAGGTCAGATCGACTTGCT
GTTGCGTCTTGTGGCCCCGCCACCTGTTGTCGCTCAGCCCGCCGTGGTTCGGCCTCCCGCTGTTGTGCAGCCTGTCGTGGCCCAGCCACCGTTGGCGCCA
ACGCCTCCGCGCTCACCTGAGCAGGGTTCTGATACGGCTTGAGTAAGCCAACGTAGAAAACTGGATGCGTGCGCATCTTCTTCGGAAGGTTAAGCGTATA
CGCTAGGCCCTTCTTGGCCACGACCTTGAACGGCCCTATGTACCGTGGTCTCAATTTTGTCTTAAAGACTGCAGACACAGCATGAGTAGGTAGGTTTTTG
GCATTTAATAAAACTAGGTCTCCGACCTCAAACCTTTCTTCATTGCGTCTGCCTTTGGCATCTGCATGTTCTTTTTGCATGTATTGGCTTTCAGCCATAG
CGTCGCGTACTTGACGCATTACGCTCAGTCTCAAAGAGACAAAGTCATCGACTTGCTGCGAGCCGCAACAGAGCTGACATCAGCTAGCCGCTCGGCTATC
TTCCCCAATCAAGCCCTGAGCCACTGCGTGGCGGCGTCAGTGGGACGCGAGGGTTAACCAAGCCGTTCACATAGAACGGCGTGTAGCCTGTCGAGGCGTG
CACTGCATTATTTAATGCGAACTCAACGAGTGGGAGCATCTGGCTCCAGCGTTTTGGCGCCTCAGCGCATCCGCTTCGGAGGATATCCTCCACAACGCGA
TTCACGCGTTCGGTTTGACCATCGGTCTGCGGATGGTCCGCTGTGGACATGTCCGAACGAGTGCCGAGCACTCTGAAGAGGGACGCCCAGAACTTCGCGG
TGAAGCGCGGGTCTCGATCCGAAACAATTGCCTCAGGCAAGCCATGTTGGCGAAAGACTCGGTCTAAAAACAGCAAAGCTGTACCTTCACCATCAATGGT
GTCCCGGCACTGCCGCTGAATGAGCCATCTTGCTCAATCAGTCTACAAAGACCACTGTACCCGTGTTTCCCGCCTTATCCTTGGGAAGGCCAAACACAAA
GTCCATACTCATGGACTGCCAGAATCCCTTGGGGACAGGCAAACTCGCCAATGGCGCTGCCGTGCTCGGCGCGGACTTTGTCCGTTGACACGTCTCACAC
GTGCGTTCATAGGTGCCGACCAACTTATACATCTTGGGCCACCAGTACATCGAGCTCACCGAGCCATAGGTCTTCTCCCGACCTAAGTGCCCGCCCACGG
GCGTATCATGAACCTCGTAGAGGATTCGATACTTTAGATCCTCATCATGAGGAACGACTACACGAGGGTTATCCTCAGAGTCGGTGCTGTAGTACAGCAG
GCCACCATCGAGTGAGTATCGATGCAGCCTCGCGCGTAAGCGCCCAGACAATTCCTTGTCAGAGACTTTAAACTCTTCGCTCCCAAGAGCCCGTAGCAGC
GCTACGCACATGTCGTCTTGTGCATACGCTCCGCGTATCAAGTCAGGCACTGACGACGTCACTGTCGTGACATGAGCTAACTCGTAACTCGGCCTGCGCG
AGAGCACATCGGTCACTACATTAAGCCGCCCCGGCTTGTACTTCACCTCGAAGTTATACTCGGCAAAGAAGGAAAGCCATCTTGCCATTCTCTGAGAGAG
ATGAGGCGACTGTGTCGCAGTGCGTAACGACGCATGATCAGTAAAGATCACAAAAGGCTTAGAGCCTAGCAGGTGTACCCTGAATTTGACTAGAGCATAC
TTCATTGCAAGTAGCTCTTTGTCATGAACTGGATAGTTCTTCTCTGCAGCTTTGAGCTGGCGAGACTCAAACGCGATCACGCGTTCACGCCCTTCGGCGT
CTGCTTGTAGTAAAGCACAACCGATTGCAAAATCGGAGGCGTCACAGACGACGCTAAACGGACTATCCGGGTCCGGTAGCGCAAGGATCGGAGCCTGGAG
AAGGCTCTCCTTCACAGCCTCAAAGGCTCCGTCGTGCTCGACGTTCCAGCACCATGGTGCGTCCTTCTTAAGGAGATCTGATAATGGCCGAGCCATCTCC
GCGTAGTTCGCACTGTACTTGTGCAAGTAATTGGCTAAGCCTAGCCACTTGCGTAAGTCTTTTTGGTTCTTGGGAACCGACCAGTCCACGATGGCCTTGA
CTTTGGCAGGATCTGCCCGTAAGCCACGCTTCCCAATGAAGCACCCGAGGAAAGGTAT