Description :
From Genome Similarity Track
Location :
Scaffold_3618:128- 2498
Sequence
2370 bases(100 bases per row)
TCTCCTCCGACAAGGCCGGTGGAAGAGTGCTATCACATCTTCGATAGCGAGACGGGTTTACCCGTCAAGGCATCTGGTGTCCACTTGGAACAGTTGCCAG
AGGTAGCAGAGATACTGAACCTCGAGGAAATGACGGCTGAGTCTTTCCTGGCCAATCTCAAGGCTGGAGAGATCGCTGAGATGGTACTCATAAGACCTGA
GACCACTCAGGAGGAGCTGAACTCCTCCTCTGTCTTGGACGAGAACGTCCTGGAATACATGAACAAGCAGCGTCAGGCGCGCTTGGGTTCTAAGATTCTC
AAGAACCCCAAGGATCCGGTGTATCCTTTGGTGACGGAGTATGCGGACGTGGTGAACAAACACCCACCGACCCAACTTTCACCGGATCGAGGTGTGCGGC
ACGAGATTCATCTCGTGCCCGGCACAAAGTATTGTGTCACGAGGCAATGGCCTCTCCAGCGCGAACAGTGCGAGGTCATTGATGCCTTCTTCGCCGCGAA
ACGCGAAGGCAGGCATGGTGCGGGAGTCGAAATCCCCGCACTCGACGCCGACTTTCTGCGTTCGTAAGCCGAACGGAAAGTGGCGTCTGGTTCACGCTTA
TAACAAGCTGAACAACGCAACGGTGCCGGGCCCAAACACCGATCCCACGAAAGGGATGTGTTGTTGAACAACATGGCCGGGAGCGTACTGTACAGTGCGC
TGGGATTTGGTAGACGGATACTACCCAAATCCTGATGCGAGAGAGCGACATCCCGCTCACCGCGGTAAGCACTCCAAGCGCATGCTTCGGGGAGTGGCTC
GTCATGCCGCAGGGCTTGTCCAACGCCCCGGCGACGTTCAATCGCCTGGTGACGCAATTGTTCCGCCCTTTGCGTACCTTCGTACAGACGTACTTCGACG
ACATATTCGTCCATAGCCGTGCCGAGGGAGAGCAGACGGTCATGGAGGTGCATCTAGGACACCTCCGTCGAGTGTTGGACGTGATGCGAGCAAACAAGCT
CTACACCAACATTGACAAGTGCGTGTTCGCGTCACCAGAGATTCAAGTTCTCGGTTGCTTCGTAAGCAACGTGGGCGTTCGGGCTGACCCAGAAAAGGTC
CAGGCTATTGCAGCATGGCCAACACCCCGATCCCAGAAGGATCTTCGAAAGTGGTTGGGCTTGGCCAACTACCTTCACAAGTACAGTGCAGAGTACGCGG
GCCTAGCTAAGCCCTTGTCGGGCCTCCTTCAGAAGGACGTTGACTGGCGCTGGGAGCAAGAGCACCAGGATGCTTTTGGCAGCATCAAGGCCAGTCTCCA
AGAGGCCCCTGTCCTGGCCCTGCCGGACGAGACGAAGTCGTTTAGCATCGTCTGCGATGCCTCCGATTATGCCATCGGGTGTGCACTGCTGCAGGCCGAC
ACAGCTGGACATGAACGAGTCATCTCGCTCCAGTCCAGGCAGTTTAAAGCCGCCGAACGGAACTACCCTGTCCACGACAAGGAGCTCCTGGTAATGAAAT
ATGCCCTTGTGAAGTTTCGTGTTCACCTTCTGGGCTCCCGGCCCTTCGTGATCTACACAGACCACGCGTCCTTGAGGACGGCGACTAACTCGCATCACCT
CTCCCACAACTTCCGCGTCGAATACAAGCCGGACAAGCTCAACGTGCTTGCGGACGCCCTCTCTCGGCGTCCTGACTATGAGTTGGTCCACATCACGCGG
GTGACAACAGATCTATATGATCGGATACGCATGGCGTATCGGGACGATGAGACTGTCGCGCCTATCGTCAAGTTCCTTATGGCCGGAGCGAGCGCGAAGT
CCGACTGGCTCTCGTCGCGACAGCGCTCACGGCTCCACCGATACGAGTTGAAGGAGGGTCTCCTCTATTACCGGGTGGAGCCGACTGATCCTCCACGGGT
GGTCGTACCCAACGACGAGGATCTGAAGTTCGTCTTCCTCGCGGAGGCGCATGACGCTCCCTCCAGCGGCCACTTGAGCCGCGAGAAGACCTTTCTGTCG
GTCTCTCAATCCTTCTGGTGGACCCACATGTACAAGTGGGTCGCCCGGTACGTTAAGACATGCGAAACATGTCAGCGGGTCAAACCCGCAGGGCACTCTT
CGGCTCCACTCCAGAGCCTGCCCGTACCGGCTGACCGTTGGAAGTCGATGAGTCTTGACTTCATATTTGGGCTTCCCGCCGACGGACACGGCAAAACCGG
AATTTTGGTGTTCGTGTGTCGGCTGAGCAAGATGGTACATCTTGCTCCAGTTCCCGTCACTGTTACGGGCGAACAAACCGCACGGTTGTTCGTCGATGGC
GTGTTCCGCTATCACGGTCTCCCGGAGACGATTGTCTCGGACCGAGACCCGCGTTTCACCGCTGCGTTTT