Description :
From Genome Similarity Track
Location :
Scaffold_64:128- 2152
Transcript NameFunction/comments
g9768.t1hypothetical protein

Sequence
2024 bases(100 bases per row)
GTACGCTATGTTCGCCATGTACACTCCGTCTTCTTCCTCCCGCTCTGGATACTCGACCAACGCCTTGAATCTCGATCTCGACGTAACCCTTGACATGGTC
ACATACAGCTGACCGTGAGAAAAGCAAGGAGTCGCCAAGTACAGTCCCAAGTACTGCACCGTTTGTCCCTGCGCCTTGTTGATCGTCATGGCAAAGGCAG
TCTGGATAGGAAACTGCCTGCGTCTCAGTCGAAATGGGAAATCGCGGATGTCGCCATCGCTGATGAACACGATGCGCGGGATCAACACATGCTGGCCTTG
CCTGTCGCCGGCCATGATGGTGGCATGGATGACATGATCTTTGAGTTCGACGATTCGTAGGCGTGTTCCGTTGCACAACCCCAGGTCGGGATTTAAGTTC
CGCATCATGATGATCGGCATCCCCTTCTTGAGTTTCAGCTTGTGGGGTGGGATGCCACTGATGTTCATGGAGTCGAGCACCTCCTGCTCGAATAAGTTCC
CGTCTTCATCATCCTCCACTGAGTCTGTGGACACATATTCTCGAGCTGGCCCAGTCATACGATCCACTACGGCTTCGTTGATACGATGGACTATCGCGTT
CGTGGTGGTGAGGATGGTGCGACTCGCGAAATACTCGTCTGTTGCGACTTCCGAATTGTTGATGTCGGCGTACATCTCGTCGATCATGCGCCGCATACCT
CGCGGAATAGCTCCCGGACGGATCTCCTCGTCCTCATCTGGATCACCGGCGGGGTTGTCGATGAGCATGTCACGTGGAATCTTCATGTAGTCATTCCCAG
ATCATTGTGTACCTCGTGTCTCCCCTCTCCAACCTTCAGCAGGTACTCGGAAAACGCAGCCATTTCTGCAGCACTATCGGAGGTGGCAGCCGTGCGAACA
CGCATGTTCTCTGTCAAACGCACCTTCAGGAAAAGTAGCCACAGTTCGGATGACTTCAGGCATGCGTCGATTGTCTCTGTAGCCGAGCAGCTCTTCACCA
CGGGGAGAATTTGCCTGAAATCTCCCGAAAGCACAACGACTTTCCCACCGAAAGGTTCTGCCTCGTTATCCAAAACGTCACGAAGCGTTCTGTCCACTGC
CTCAAACGTGTGCCGATGCGCCATGGGTGCCTCGTCCCAAACTATCAAACTTGCTTTCTTCATCAATTCTGTGACCTGAGATCGCTTGTTGATGTTGCAA
GTAGATTCACCGTCTATCTTCTAGGGAATTTTGAAGGTAGAATGCGCTGTCCGACCTCCCATAAGCAGCAGAGAAGCAATCCCACTGGAAGCGACCGCGA
TTGCAATTTTTCCGGATAGACGAACCTTGGCCAGTATGTTCCGAAGCAGTGTCGACTTCCCGGTACCGCCTGGTCCATCAACGAAGAATAGCTTCCTGCC
TTCCTGTGGGTCCTCGACAGCTTGAGTGATCTGATCATAGGTCAAGCGCTGCTCCTCATTTAGGTGGTCCTCCTCGCTCACAATTTGTTCAAGAACAGAC
GCATCATATCCCGTTAGCTCTCGTCGGATGAGATTGTTTTGCAGAACAGACTCAAGCACCAGGCGAGGGAACTCGCTCAGCCGAGGGAGATCAAAGTCTT
GGACGGAGTATCCACTGACACTGAGCAAGTCTTGGATACTCTTCAGTGTGTCGAACGTCACAACAGACGTTTTAAAAGGGTCCAACATCTCTCGGTTCCT
GTAGGCATAGTCAAGCAAAAGGTCTTTGAAGAATTGGCCCCAAAGACCCCGAACATCCGTAGGCGCCGAGTAGACCAAGATTGTTGCAAAGAGCTGGCGC
AGCTGGTACGGCATCTGGAACTCGGCAGCCTCCGACAAACACAAAACCCATTCGCTGTCGTTCTCCAGATAGCCGGCATGTTCAGCCGCGTCTCGATACG
TGGGACACAGCACACCATCAACTGTCCGCAGGTCTTCGAAAGACCTCGGTCCTCGGCGATGGCATAATAGCAGGCGTAAATAGAAGCGCTCCATATCACG
CGGTGAAACATGCACCACCCGACC