Description :
From Genome Similarity Track
Location :
Scaffold_75:128- 1714
Sequence
1586 bases(100 bases per row)
GCCTCTACGTGCTTTAGTTGACACTGGTGCGTCGAACAACTTTGTTCGAAATGAAGTGATCACCAGGCACAACATCTCTGTGCCTGTTGCGAATGAAGAG
AAGATGATGATTGTTCGGTTGGCCAACGGGTCACTGTGAAGATGCCAAAGCGAGTTGTTCGCTTGGCAATGAAGTATGAAGATTTCCGAGGTGAAGACGA
GTTCATTTTACTCGACCTCGATGACAAGTTTGATATCATCCTGGGCATGCCATGGTTGAAGCGTTACCAACCTAGCATTGACTGGATGAAGATGAAGATC
TCCGTTGACAAGTCGTGCATCGCCGACTTGAGCTGCATGACAACGGATGAAGTGGTATGGGTTTACACATCTGTGGGAGAAGTCCCAGATGGCCCTTGTG
ATATTGCGGTGTGCGATGGCCCCCCATGCTCACAAGCGGCACCCATTTTGAAGAAGACGAACGGAGGTGGAGCAGTCAGGCGCCATAAAAAGACTGTCTC
CTTTGCCATCGACGACAAAGTTGCGTGCGATGGTAGTGTGAAGAACGACGGGAAAAGAGGCAGAGACCCATCCCAAGACAAGAAGAAGAAGACCAGCAAG
AAGAGTGTTCCGCCAAGAATTTTGAGTGCCCCTGATCAAGGTACAAGTCAAGATGACGAAGGAAGTGTCCAAGTAAGAGTCACTTCGAGCGAGTTTGTGA
ACCTTCTGGTCTCGAGCGAAGATGGTGACGTCGATCTAATCCGTCGCGCAAAGATTGAAAACCCTCCAAGTTCAGTCGAAGAATTGATTTCCTTGCCATC
GATGAGCAAGAAGACGCTGAAGCGTAGCCTAACGAGAGGCGAAATCTCGCAGATCTGCATGATCGTCGATGTTGACGATGCAGAGGACATCGGCACGGTA
TCAGCAATGGAAGCTGAAGTGCTCGATGGGAAGTCACGGAAAGGAAAGGTTTGATGAGCAGTCGTGGGACGCTCTCAAGATGAACCCCGTGTATGGACTT
GTCAAGGAATATGCTGACATATTTCCAGACAAAGTGCCGGACGACTGCCATTTGATAGAGCATTCGTCACGAGATTGACGTACTTCTGGCACGAAGTACT
GTATCACACGACAGTGGCCGTTGCCAAAGGACAGTCGAGGCAATTGACGAGTTCTTTGCGCAACGCGCGAAGGCTGGGCATGTGCGGGAGAGCAAGTCTC
CGCATTGTAGTCCCACTTTTTGTGTGAAGAAGGCGACTGGCGGATGGCGCATTGTTCACGCTTTCAACAAGCTGAACGACGCGACTATTCCTGCTCAGAC
TCCGGTTCCACGCAAGGATATGATCCTTGATGGGATGGTTGGCAGCACCGTCTTTAGTGCTATCGATCTGAAAGATGGATTCTATCAGATTCGTATGCGT
GAGAGTGATGTACCATTTACAGCAGTAAGCACCCCTAGTGGTATGCTGTGGGAATGGTTAGTGATGCCACAGGGACTGAAGAATGCACCCGCGACCTTCA
ATCAAGTGGTCACGAACGTTCTTCGTCCTTTACGAACATTCGCACCGAGTTACTTCGACGATATCTTCGTTCATGTAAGGCCACGA