Description :
From Genome Similarity Track
Location :
Scaffold_3953:128- 1643
Sequence
1515 bases(100 bases per row)
GATCCGACGAAGACGGAAGATGAACAAGTCTGTTAGCATGAAGGCGGGAATCTACACGCCGAAGATCTCGGGGACGGCCTGGCGGTAAACCCGGAGGCGC
CACTGACCACAGAGGAGGTCACGATTGACGATATCCAAGTGGATCCAGGGGCAAACGAGCCCGCGGAAGTGGATCGGTTACGTCAGAAAATCTGGGAAAG
CCGACATCTGCTGATTGGTAAAGGTGATGCATTGCCGCCCGCCGCCCGCGGGGTCAAATGTGACATCGATGTCGGCGACGCGAAACCGATCGCTCAAAGG
GTGCGGAAGGTGGCACCTCAGTTCCGAGAAAAACTATCAGATCTGATTAAGGGCCTGCTGCAAGCCAAGATCATCAGTTTCTCGACATCCCCGTGGGCAT
CTCCGGTAATAATCATCATCAAGAAGAACAGAGTGGATATACGTCTGTGTATTGATTACCGGCTAGCTAACGACCTGACCCGACTGATGGTGTATCCAAT
GCCTCTAATTAATGAGCTATTGGAGGATTTGGATAAAGTACTCTGGTACTGTTCTCTAGACATGGCCAGTGGTTTCTGGGGTGGTTACTATGACGGATCG
AGCTCGCGCGATATCCGCATTCATCACACCGTTTGGACTGTTCGAGTGGAACCCGGATGCCGTTTGGATTGAAGAACGCACCCCAGATCTACCAACGCCT
GAGCGATAACGCCCTCTATGGATTCACCCGAATACCGGAACCCGAAAAGGGTGGATCAAGGGAAGATCACACGGAAGTGGATCCATTCGAAGCGGGGGAG
CCAGGGGATCCTAAGACCCCGTCTGTGTTAGGACGCAGATCTTATATCGACGACATTCTAATCCCGGCGGAATCGTGGCATAAGCTGTGCGAGAGAGTGA
CATCCCTACTGGAGGCGTGTACTAAGTGGAATCTCTCTATCAGTGTGGTGAAGAGCTATTGGGGGATGCGCAAGGTGGATTACTTAGGCCATCGAGTCTC
CAAGGAAGGATAAGAGGCGAATCCTAAGGACCTGTCTTCGTTAGCCGACTTGTCCTTCCCACAGTCGTTACGGGCGATGCAATCCTTCTTGGGCAGTTTG
AATTACTACAGTCGGTTCATCGAGGATTACGCACTGTTCGCTGCAGTACTATATGAATTGAGAGAGGTAGATTTTGCTGCGATGACCACTCCAGCTGTCC
GGATCAAAATCCAACAAGCTCTGGCCCTGGAGATGTCAGATCCACGAAGGGATCCAAGTAGCCAGAAAAAGGCCTAAAACAGGAGCTGGATCCGCCCCGG
GACCAAAAGAAAGAGGATCCGATCAGGATAGAGACGACGAACCAGAGTTCGGAAAAGGCGGAACCTCGGTGGATCCGAGCTCAACACGCATTTGTAGAGC
TGAGGAACAGGATCGCGACCGCACCTATCCTCCGTCATTTCGATCTGGAACGTCAACCTACGGTAATCGTTTATGCCAGTGACTGGGCAGTCTCAGCAGC
TCTGGTACAAGATCA