Description :
From Genome Similarity Track
Location :
Scaffold_3066:128- 1182
Transcript NameFunction/comments
Phyta_totarag15045hypothetical protein

Sequence
1054 bases(100 bases per row)
CTTTGAGTACTGAAGATGGACCGCTCAACCACGAGAATGCCGAAGCACCATCCAGAAGCACCGACAACAACACTAATGGTACGACTGTTTTGTATCCTGT
ACTGTTCAATTTATGTCGATAGACTAATCTTGTATGCTGCACTGTATCGCGCTTGTAGCAGCTCTGAGTGGTTCGAAGAGGCAGACTGTCTGATTCAGTG
ACGATAtggctggagctgacgaTGTGGAGGAAGCCGGTGACGATGCTCGATCGCCGCTAACTTGGTGTTGAAACTAGCTCGAGCAGTACGGCTTTGTCCT
GGTTTGTATTATACACGCTAGCTGCGTCTCTTAGCCTGTATTCTAACCATAATTACGTATTATGTTGCAGGCCTACTTGACCTAGCACCTGAAAGTGAGG
ATCCGTCGTAACTTGGACGATGATTTTGCGACGCAGAAGTCAGGGAGAGTGAAGGCGGAACTGGGTCACGTCGATCTACTAGAATTGGTTATTGCGCCtg
tggagaagtggatgCCGAGAaagtggtggcggtggcgacCAAGACGTGGTTGGAGTGATTCAGATGGCAGAGTGAGAGTTCGAGACTACAGGGGTAGGAC
TGTCCCCGATCTGATGGGTGTCAGCCTGTTACCGCAATCATTCTCGACAGGGTGCCAATATTCGGGTGCACACCCGATCAGACCGATAGGGTACCGGTAT
TTCGGTACATTGCGATCGGATCGGCAATGGAACAAGGATGTGATCATTTCGACACAGGTACCGCGATCTAGGTACAATTTTTTTTGGGAGCCAGTGTGTG
CCACGATTGGCTGATGCGCAAGCAGAATAGGAGAGGAGTAGCTTGCATGTTTTACTTTGGTTTGTACAGCCTTCGAATTACCTTCTAAGCTGCAAGTGGT
GACCTGATTCCGGGCTGGGAAGTACATTGGGCCCCCCGATGACAAGGTTCTGCTAAAGCGACTGCAGAgagaacacgaagaagatccGCTGGATAGCGTG
GCCAGGAGCGATCAGATCTCACCCTCAAGACTCCCCGTCAAGAGTAGGCGGAAA