Description :
From Genome Similarity Track
Location :
Scaffold_77:12798- 16138
Transcript NameFunction/comments
Hyaar_Emoy2808237hypothetical protein

Sequence
3340 bases(100 bases per row)
CGAAATTTTAAAAAGCAGTTCTCATTAATTCTTGCTGTAGATACGGATTTCATGAAATACCTATGATTAATGACCCAAAAACATTTCCAAAACCTATTCC
AGCATTATATAAATTTAAAGTTGCTAATCCTGCACCAAAAAATCTAAAAGCTTGTAATAACATAAAGTTTATTATTATTGTTTTATATAAAATATTAAAA
ATTATACATTTTAAATTTAAATAAATACACAATAAATTATTTTATTTGAAAATGAAACGTGATATGTATTTTGAAAAATAAACTTGATATATTTTTGCTT
CCTGAAGAAACGAGCTAAACTATTCATCGTGGCGAGTTGTGCTAGTGAAGGCCATCAAGGAGGAAGAAAGCATCAAGCCGGCGTGGGAGGTAAGCCGGGT
TGTGTCGCGGATGATCGACGCGATCGTAGAAAAAGAGGAAGAGTAGGAAGGAGGGGAAAGAGTAGATTAATGGAAATATATGTATTGTTTTGCAGTCCTC
TTCTTCTATTGTTCATGGCTTCTCGTCGTCGAATTTGTTATATGTTGTGAGCTGTGTTTGGAGGCGCACTAGAAAATTTGAGGCTGCGTTCAGCGGATCT
ATGCGCTCTCCAAGCGCTTCGAAGTGCTGGATTCCTTCGTTGATGATTCTCAGGAACGTTTCGTGCGTGCAGCTGGTGCCGCCGACCCAGTTCCAGACAC
GCGCAAAGAAGACCGGCCGCTCCGACGTGTGGTAATCTGCATACTAACCGTCAGAACCGTCAGATTCTATATGTAGGACATGGAGGAGCAACACGCTTAC
CAATCGGAGCTCCTCGGGTGATAGGATGCGTGCGAGTTTTGCGTTGCCGAAACCTGGAGCGCTGCGACGAAAGTCAATGCCGTTTCCTGACGGTAGAAAA
CGAAGCTCATCTTCGCTACGCGCTTGAAGTCGCCGTCGTCTTCCTTCTAAGTACACAGATTGACCTCCGTAGACAGTGTAATTAACATGATCACAGTCAG
CGGAGCGTATGAGAAGGTATTCGTGCTCCAGTTGAGTCGTTGGGGCTTTGGTCGCCTTTTCCGAGTGATGGCGAATCAATCGATCTCGCGTCAAAGACAC
TCCAGCGCGAATCTCACCGGTAAGATCGCTAATACCGTCCACCATGCGGTTGAATCCGATCATCATGCGGCCAAATCTTGCGTCGTCGCGGCTGCGTTCA
TCGGTGTGCACTTAAGCGGTGGCTCGAGTGGCGGCTCGAGCGGCGGCTCGAGCAGCGACGACGTTCATCACGAGCTGCTGGTTATCATCAGCGAGGCGCT
GGTTCTCGTCTTCCATGTCATCCATCCGGGCGTGGAGTTGAGCGAGTTCTTCTTTTATCGTCATGATAGCGCGGTGTTGTTGAGTCTTTGTGGTGGAAGT
TTTTATGGTGCCGCACTTCAGTCCTTATGGTGCCAGCCAAGGTACCGTGTTGCCTCCCGGGGAAACAACACGGGATCTTGGGCATCAAGTTGGTACAGGG
GTACTCACTGATGTCATGGGGTCCGTCCGAGTTCGTAGCGCTTGCCGTCGACTCGCGGCGGCCACTCGAGTGGAAACTAGTGTCTCTCTACGGGTCCCAG
AGCTAAAAGGAGAAGGAAGTCATGGACCGGCCGGTCGGTGACGACGACGCACTCATGCCAGAGAGCCGTCTCTCACGATCCAGCCCTTCCTCATGAGCAT
CACATCGACGAGCTCCAGAGACAATCCTCTCGGCCTCGCCACCCCGACCGCGCTAGCTGAATCAGTATCCATCATGATGGTCCAAGTGCATTAACTACAT
AGTATTTAGCTTGCGGCCGTACCTCAAATACGGCAGCTGTTGATGGATGCTATAAATGCTGTCGTCGAGGGACACGCCATGATTGCGACTTTTCCAATCA
AAATGCAGGCTTCTATAGCCGATGCGAACGAAGTCACTGGAGAAGATTCTGCGTCAACGGTTGTCACTGTAATGCAGTGAAGTGGTCGGGAGGAATTCTG
ACCAATCGCATCCTTTCACACCATGGGTGCATGTGGGATCGATCACGAAGGCGTTGAGACTGACCGTCGGAAAATCTCTAACGATGTGATAGAAAGTTGA
CGGGTCATGACCACCAATTACGGTCATTGGCTGTGATCATTGGTCACGATCACTCTTGATGACCGTCGTTCATGGTCACTGACGATGACCAGTGGCCGTG
ATCACTGGTGATGATCATCGGTCATGGTCACTGTTGATGACTATCGGTCACGATCACCGACTTTGACCATGTGGTCATACTGGTGGTTGGGGTGTGGGCC
ACTTCAAGGCCAAGGAATGGATGGCGGGGGACGAAAGACGTAACAGAAACTGAGATACAGAGAAGCATAAGCGTAGTTCAAGCTCCTAATAGGTCAGTAA
CGAACAGTATTGATTTTCTTACAAAAGACATGCGTCAGCATACCTCCTGGCTGGAATACTTGTGGCCACCCGACATTCAAGGTTTATTGCTTCACGTGTT
TGCTCAAGGTTTGTCCCTAGATTTCTTGACTAGGGACGAAGATACTCATTCAAGTTATCCCGCGATCGGATGCGGCAAGCATATAAAGGCAAGGTCTGCA
GACGGCTCAAGTGATCAGAAGAACAAGGTGATCAAGTGGTCAGAAGAACAGTGGGATCAAGTATCCACATTTGAGCAAGGCGACCTCAAAGAAGGCCAGG
GCGACTCTGGGAGAGTGACACAAGTAACTATTGGTCGTGTGAAGACTTTTACGCGACCACACCCAACCTATCCCCGACTCGGTCAAGACAGACATCGACC
TCAACTCGCCTAGAAGAGTGCAACCCGCCTTACGACGGGTATACAAGGTGAGAAGGAACAAGAAAAGACATACAGTCCGGAGTACCCCCTCCGTTAGTCG
GTTGTCTAGGCGCCAGTAAAGAGTTGGGATCGCTTCAGAAAATGAGCGAATACCACTCCACCACAATGGTGCGCGTGCCCGAATCTTCTGGTGACTCGGT
ATTTCACCGTGAATACCGGAGCGAAGATGTCAAGATCAAGGTTGAACCGGGGATAGTAGTGTCGGCGAAGAAAGGATTGTGGTAGACACGTGATCATCAA
CCGCCGGAAGGAACACGTCCAGCCAAAGCACGACATGTTTGATCAAACGCCAAAAATATATACAAAGAAAAAAGATCGAAGGCTGCGGCTCAGAAGTTTT
GAGTGCCTGAATCTGAAGGCGACAATCAGGAAACGAGTGAGGCAAAAGAGGTTAAGACGGAAGGCTGTAAGATTGATCAGTTACAGCGGCGTTTGCACTG
TACCCAGCTTCAAACCTTGCTATTCACAGATCCGATGCTA