Description :
From Genome Similarity Track
Location :
Scaffold_636:12792- 16155
Transcript NameFunction/comments
Pytir_DAOMBR486fgenesh_masked-pir_contig_636-abinit-gene-0.29Leucine-rich repeat-containing protein 56.
Pytir_DAOMBR486maker-pir_contig_636-snap-gene-0.11Conserved gene of unknown function

Sequence
3363 bases(100 bases per row)
CTGGAGCTCGAGTCGCCATCGCCATCATCGTCCGATTCGAATTCCCGGGGCGTCTTCTGGGACACGCGGTCGTTCTGATGGCTCACCGTACTTTGCTGCC
CAAGTGGGAAGTTCCGCCAGGATGCCTCGGCCGTGGTCAGGTCAAGCGTGGGCGAGAGCGCGTCAAAGTTCCACTCGCGGTCTCTTGCGCTAGTGCTGGT
GGTGAAGATGCCATTGGACGACTTTGTTGGCGAGCACGGACGCCTCTCGTTACCTTCGTCCAGAATTAAGATGTCGACAGTTCCACCAGAGGAGCCAACT
AACTTTGACGAAGCGGATGAAAATGACGGTCGGTGGTGCAGCACGGCGGGTGACTTGGCACGTGATCCCAGCACTCCACTACTGCTGCTCTCGCGGTCTC
TTCTCGTCTCGACAAACGCCTCTTTCACATTCGTACCATTGCGCAGCACACCCGCCGACGTACTTGGACGTGCTTCTTTTGAGCGAGCCGAGGCTTTCCG
CTTCGATGGACTGCTGTCGCGGTGGATATGGGTCACTCCGAGTTGCGACACCGCGCCTTCCTGCTGCCACGCCTTGAGCTCGTCCAGGATCGCATCCCGG
GACTTGTGTTTCTGGGTCTCGAGTTCGTTCGCGCGGTCGAGCGTGTCGGTGATGGACATGCGCGCCGGGGTCTTTGGTCGCTCCATTAGAAGCGGTGTGG
AGACCCTGCGGCTGTTGTTGGTGGGACTCTCACTGTGGGGTGACGCACATGCTGGCTCAGTTGCACCATCACCAGCCCCGCCACTATCAACCACTGCCAC
CAGCTGCTGCGTGAGGGCTAGTCGCACGTCTGGCTCGCTCTCACTTCTGTGGCGCCGCAGTGCGCTTGTGACGTTTCCTGCAAACACGATGTCCGTACCG
TGCGTCAAGCTGCTTCCAGAGTCACTGTTTCTCGCTTCCTGTATGATCCGTGAAAATACAAACCAATGCATTAGTATTTAGTGACTCCTTCACCTTCCAA
ATACTTCCCTGGTTGCACTTACAATCGCAGGATCAAAGCCAGCAACGCGCTGGGTGCTCGAGGTCCGCGAGAGTTTGCGCGGACTGCGGTCATCGTAGTG
GCCCAACGACGCTGACGACTTAATCCCATCTGCGATCAGCAACCTGTCGTCGATTGTGCACGCTGGTGTGGAGTTCACGCCTACGAGCAGCTCTTCCTCG
TGCGCCTTGATCGCGGCGTCGATCTCTTCGTCCGAGATCTTGATACGCTCGTCGTCTGTGATCGGTTTGTCGTCCAGAGTAGTCAGCTGAGGCAGAAAAT
TGGCGATGATCTGGCGGTAACGCGCAATTTTGCACACCGGGTTCGCTTCGAGGTTGAGCGTCGTCAGCTGAGCGCAGAAAGCTATAGCAATAGGTTGATC
AGAGTGTCTTTGCAACGTTAGCCTTTGTTCTGACTATGGCAACGATTGCACCTCTGCAAACGTACCCAACTGCTCGATCTGTCCGATATCTGCTATGCAG
TTGCCCTCCAGATCTAGACACAATCAACCAATCGTCGACAGTGAGCCTCAATATCCGATATCACACCCATTTATATAGCGTATCTCTACGTACCTATGAC
TTGGATCTCCTCGTGCAACGTTAGCGGGCTGAGGTCGCTGATGTCGTTGTACTGCAAATAGAGCTCCTGAAGCCCCGTGAGCGCGCCGATCCCGTCTAGG
TCGCTAATGCCGCTCTTCATGACCCAGAGGATCTGCAACGAATGCAGCGACGTGCCCAGGTCGCGAAAGCTGTGGAGCGTGCTGTTCTGCAGCTTGAGCT
GCTGGAGTGACGGCAGCAGCTCACCGATCGCCTCGACTGACTGCTTGCCCGAGTCCACCACGATCTGCAGGTATATCACGCGTGCCAGGTCTTGCTTGCC
GCTCAGTTTTTGCTGTTTGCATATTCACAATAAGCCTACTGTTAAACCCCACATACGAATACATGCATGATGCTGATGCGCCATTTGTACCAGCTTCTCT
TCAGTAATGTCGTCGAACGGGTTGTCCGACAGGTACATGTTGCTGTCTACTGTCGCTGAGAGTAGCGCCTTGGGGTGGGGCAGCATCCGCGCTGTGGGAG
AGAGCAGCTGACTGCCCGACGCGCCTCCTCCATTGTGCGCGGTCACGGGCGTCGGGTTGCACTCCTTCGGCAGCGTGCGAATGAGGAACTTGGCCTTCGC
GGACTCCATCGTACGGATTGCGCCGGTCGGCGGCTTCGTCATCGACGCTCTGCTGCTGCTCAAAAGCACTACCGAGTCGTCCATTTCTTCACGGAGATCG
ATCGCTGGTGCAACGAGACTCATGACCGACAGACAGACACACGCGTGCACTCTCTCTCGCTCTCTCTGTTTGCTGACCTATAGACAGCAAGTGAAGCGAG
CGAGCGAGCGCTGCTGTGTTGTGGACTTGTGCCTCGTAGGTCATAGCGAGAGCGAGGAGCTATTTCCAGGGCACAGTCCACATTTTGGTCATTGTTGCCT
CTGCGTGCTATTGTTAGGCTGACACAGGAGCCGAAAAGCCGTAGCACCCTTATTCAGCAATTCGAGGGCACCACAAAGTGCAATTTTAGGACTGTGTACT
CGTCAAAGTGCGATTATAAATCAAATGGCGGACATTCGTACTTTAACGGGACTCAAATCCAACCATGACTCACACTCGCATTCGCATTCGCTTGGTGGAC
GAGACGAGCAGTTCAATTGGAATGGACGCTGGGGTGACGACGACGAAGCCAGCGGGCGGCGGCGTGGCGGTGCCTCACGCAGCAGCAGCGAGACTTCCCG
CTGCAGCAGCTGGTGTCACTGCCGGAACCACTGGCGAGAGCAAGCGCAAGGCTGACTCCTCGTCCTCCTCTTCGTACGTGTTCTTGCGCATCAAGCGCCG
TCGCAATGAAGAGCCCGTCGAGTGTCTCGTGGTGCAGAGCGAGCCAGAGGTGAAGAAGCTGGCGGTGCGCAAGAGTGCCGATGCCGCAGAAGAAGAGAAA
AAGGGAGGTGGTGATGACGCAGCTGCTGCGGCTGCTGATGCTGATGGAGAGAAGAAGAAGAGCGCGTCAGTAGGTCTGCTGAATGCGTTCACCAAGCTGT
CTACGAAAGAGAAGAACTTTGTGTTCAAGCGCATCGATACGATGGAGAAGCACCAGCTGGAGGAAGCGAACCACTCGAAATGGACCGATCGCTTGAAGCG
CAAGGTCAAATCCATGAAGGAGGAGCCTCGACCAGCGCTGAAGAAGAGCGGCGCTGCTGCTGCTACAACGATGGCGGGACAGAGCCTCTCCAGCCAAGTG
CGCCTGCAGCAGCAGCAAGAGCGCGCCAAGGAGCGCCGAAAGTCAGATGCATCGCGCTCGCGG