Description :
From Genome Similarity Track
Location :
contig_3:1279012- 1283638
Transcript NameFunction/comments
g1039.t1hypothetical protein PPTG_05417
g1040.t1serine/threonine-protein kinase

Sequence
4626 bases(100 bases per row)
CGCAGCAAGTTACCGGCCAACCAAACGTCAACTAGCTTGCAGCATGGCTCCGACTGCTGGTATGTCTTGCTGCGTGTGTGTACCTACCCACCTCCGCTGC
AATAACGTCTAACATCCCTACGCTTCCCTCTCGACCGCAGGCACCCGTCTCCGCTTCAAGAACTCGCAGCCCAAGAAAACGCAGCAGACCAAGAAGGTTC
CGTCGCTCAAGAATCGCATCCGAGGACTCGAGCGGTTCCTCAGTCGCGGGGTGCGTTGGCTGCAATTGCGAGTGTGGAGCGTTGCATCATTTGTATTGTT
TCTAATATTTTGCGTTATTGGTGATGGTGGTGCAGGGGCTGGCTGATGCTACGCGGAGAGCCAAAAAGGCGGAGCTCCAGCAGCTCAAGGAAGAGGTTCG
TGCACTTCGCATCATAATATTTGTAGTTATGCAAATAAAACTAAAGTTGTGGTTTGTTGATGGTTGGGTAACAGCACGAGCAGAAGGGAAAGGTCGCAGA
GGAGAAAAGAATGCCGAGAAGTACAAGAGGGTGAGTGCACGCAGCCAACATTGCTACGTAGCAACACTCGGGGCGTTTTGATGAGGTGATGTCTGACTTG
GAGCTGGTGTTGATTATGTCCTAGCCGCGCTTTTTCGAGCGTGTGAAGGTGATGCGGAAACTGCGTCAGGCTAAAAACCGCCTTGAGCAGGTGAGGAAAT
TTGTTGATCACAGAGTCGCAAATATGGGCTGAGTACGACTCTAATATTTGTTCTGGTCGTAGGCAACGGATAAGGCCGAGCGTAGTGAGCACGAAAAGAA
ATTCCAGACGTACCGCGAGGAGATGATGTACATCTACTACTACCCGACGAGCGAGCCTTACATTTCACTGTTCCCGTCGACACCTCACTCGGAGAAGAAC
CAGAAGCGCCAGAAGGAGATTCGTGTTGAGGCGATCGCCCGTTTCGAGGAGGAGCAGCCTACTCAAGAATTCCACCACTTTTGCTTCAAGACGAAAGATT
CTGCCTCTGCAGGTGAAGCTAGACCGGTTGTGGAGCTTCTGCTGAAGAAGCCCAGTAAGGAAATGGTGAAGAAGCAGAAGAAGGCCCGCAGCAAACGTGA
CAAGTCAGGTGAAAAGCCGAAGCACACTCCAGCTCTAGTTGACCAAGATGACGATGATGAGGTGCCGGATGCATCCAAGTCGGAGAATGAAAAGGAAGAG
GAACTGGAGGAGGAACAGGAAGAGGACGACTTCTTCTTGTAAGTGTCGGTACAGAATATAGTTGCAACGAGTCGGGTCGTTGCTGTTCACATCTGTGCAG
ACAACCGTACGTTCAAGGTTTTCGTTCTTGCGATTTATTACTTCAAAGTACTAATAGTCTTTACGCTGACGAGCTCATAAGGAGGAGGAGGAGGAAGACA
ACTTGGACACGAGAAGTCTGTAGAAAAATATGAGGAGGAAGCATCGGACGATCTCGAAATTCAGCTAAATCAGAATAGACGGAGCGCCCGCCGTGCTTGC
GGTTTGCTGCTCTGTGTCAGTGATCATGTCTGCTTCAGCTTGCGATGCAGCCGCCAATGCGTTCATGTTGGTGAAGCTGAAAGACCTGAATGCATCTGAG
AGGTTGGAATCTTCGGGACTACCGTACATTCCACTTGGGAACCGATAGTGACTATTGTTGTCTTCCATCGGCAGTCCGTCGCCCATGTATTCGTCATGAG
TAGCATCCACTGTGTCAAGTGCATTTAGCGCTCCTGCGGTCCCCCACGACATGTCGACATCCGCTGTACCTGCAGAAGTACAGCTTGCGTTGTTGTCACC
ACTGTCACAATCATCTTCTCTTTTCGGGTCAGACGAACTCAGTGGCTGATCGTCATTCTCAGGCCCAGAGTCGATGTTGTTCTGGCTGCTACTGGCGGAA
CGGGAATCGACATCAAATTCGTCGTCGTCGATGAATATATCCGTGAGATTACGGTTGTTGAAATAGCTGGTGTCGTTCGGCCCTTCCAGTGTCGGTACGA
ACGGAGGTACAGATTCCAGGATCGTATCCCAATTGATACCATCGAAAAATGGGTGCAGTTTGATCCCCTCCCAACCCATACGGGCTGCCGGGTTCGGGTC
GAGTAGCTTGTCTATCAGGTCCACCGCCTCGAGCGACAAGCACTTCTCTCCATCGGGCCACAGAATTTGCCGCTCGAGAATATTCCCGAAGATCGCTTCC
ACAGTGTCATCATTGAACGGAGGAAAACCAACCAGCATTTCATAAAGGATAATTCCAAGAGCCCAGTAATCCACGGGAGGGCCGTGAGGGACCCTACGAA
TGATTTCAGGCGCCAGGTAGTCCGGAGTACCACACCGTCCATACGTCTGATATGCAGACTTATTTTTCAAACTCCTTTTCGCTGATGAGGTGTGGCGTGG
ACGGCTATGTGCTGGAGCAGACGGCGTGACTCCCAGTGGAGTGTCGGGTAATATATCCGAATCCTGGCCATGGACTCATCGTCAGGTTCCGAATCCGAGT
CACCAATTGTCACGGCTTCCTCGGACAAACCGAAGTCGGTCAGCTAAAATGTGGAAGAGAATTCCAGTAGCGATTAGAGGTGAAACGATAGAGACGAGAA
ACTGTATACAAGTACTAGTAGCTGCTAACCGCACCTTAATGTGTCCGGTTGACGAGAGCAAAATGTTATCGGGCTTCAGGTCTCTGCATCATCATATGCC
AAAAACCAGGCAAGTGGATAGACAGACACATGAGTGATCGATCTATGATAGCGTGCAATAGCTGCGAATTGAACTGTCCAAACCTGTGGACGCAGCCTTT
AGTGTGCAGGTGATTGAGCGCGATTGCGATCTCCGCAATGTAGACGCATGCCACCTGATCAGGGGTAAATCATAGTTCGTTAGCATCATTGATCGTACTT
TTTGCAACATGCACACAAGCTCACCTGCTCTTCCAACTGCACAATGCACTCCAACAAGGACATGAAATCTCCACCGGGAAGATATTCCATCACGAGAAAA
AGGTTGCGCCTAGCGATGTCACCAAAAATAATATCAGGTATGAGCTACGCGGGTACTATGAGCTTAGTGCTGCATGTACTGCTTACTTGGTTTGAAACGT
CCAGAATAATTTCACGACGAATGGACTCACGACGCTGGCGAGTATGTTCCTCTCTGTTTCGATCTGCTGAATCTGTTGGTGGCACACAAAGCGAGCAACA
GAGCAAAATGCTCAGTAGGCAGCCCTGTGATAGCAACCATCCCAGGCTGCAGGCAATGCGCTGTACCTGCTTTTTGCGCAGCAAGTGCTCTTTCGCGAGC
ACCTTGATCGCATACTGATCACCAGTTGTCTTCTTCCGGGCGAGATATACTTTACCGAAAGCACCTTTCGAAATAGGCTTAACAATCTGGAAATCACGGA
TCGAGACACGATAGGAGGCTGGCTTCAGACTCGCCCGGCGCGGTGCTCGAAAGCCATCGCTGCTTTCGATATTCTCCAGGGACTTGGTGCGTTTTAGCGG
CGTTCGCACTACCTCGACGGGGGCTTGCTGGAACATCACCTTCTGAGATGCTCGCATTTTGCTCATTTTGGCGTGGATCAAGTTGCGCAGCTTGGTGCAG
TATTTGATCCCGCGTTCGACGGCAAAGTTGGGTGTCTCGATCTCCTGTTGTCGTATTCTATCGATAATTTTCACTAGACGTGCACACAACGCAAACGCGT
CGACACTAGTCACATCACAAGTCGAAGCCTGGATCGCCACTACACGCAGTGCGTGGTAGATGTGCATTTCCTCCTGGTCGAACATGGGTCGCATGGCCTG
CGCGCTCAGCGTGGCGTTAATCGAGGCCGTGAGCTTCACCAGCGAGTTGTTAATCACATCCGCTTCCAGCTCCACCCTCTTGGACAGTACGCAAAAATTG
GTATGTTCGTCCAAGCTGTTGGCGTCCACTTTCGTCTCGCAGAGCTTGCACACGACCACGGACTTGTTGGCGCGGTGGAACGTGACCGTCATGGGTCGTT
TACTGAACTGCAGGTTGTCCAGCACGTCTTCGGGGACGTGGCGGCCATGTCCCGTCCATTGATGGCGTCCACCATGAGTCCCCTCGTGATGGTCACTCCC
GGGGAATGTGCATGACCACCGTCGTCCACGTCTCGAGGTGGACGCTCTTGATCACGACCTTGTTCTTCTGGGTGTCAAACACAAACTCGAGCCCCAAAAA
GCCGTCCCCGAACGTCACGTCAAAGGTCTCACCCCTCGGGACGTCCTCAAACAGGTCTCCTCCGTCCTCGAGCATGGCCACGCCCTGGTCGTCGTCCTGG
TTGCCGTCGCTAGATGCGAAGCGGCGCCACTTGACCTGGTTCTTCTCCCAGCGGTTCAGCACGTCCTCCAGCACGTCCGGAGTGGCGTCCAGCAGCCCAC
TGCGACTCATGGAGGCCCCGCCGCCGCTGAAGGGCGGCACGTTGAGCGTGTACTGGCGCTGCAGCCGCTGGGGCTGGATCTCGAGACGTAGCTCCTCATG
GATCCGCTCCATGTCGCTGCTGCTGGTGCTGCTGGCGCTCGGGCGGCGCCCGCTGCTGTCCGTGGGGAGCTGCAGCTCGGCCACGCGGGCCAGGGCGAGC
TGCTGCAGCCGCTCGGCCATGAGGAA