Description :
From Genome Similarity Track
Location :
Scaffold_791:12788- 16276
Transcript NameFunction/comments
Phyta_totarag10735hypothetical protein PHYSODRAFT_504737
Phyta_totarag10736conserved hypothetical protein

Sequence
3488 bases(100 bases per row)
GTACGAAGGCGAGTTCCACGAAGGGCTCCGTCATGGACGCGGTGTATTCTTCTACGCCAATGGGGCCCGGTATGAAGGTGAGTGGAAAGGCAACGTCAAA
GACGGCCACGGTCTCCTCTTCTACGAAGACGGTCGCGTATTTGTTGGCTTCTTCCGCCAAGATCGCAGCGTCGAAGGTTCCTAcgcaacggcagcaactg
TAGGACTTACGGTCccagcttctccaacacCGTTTGTACCACCGCCTGAGTCTcgagcacctgcagcagctttaTCACCTTCTCAgctggcctcgtcgtc
ctctaGCATTGCTGGTATAATGCTATTTATCAACGATCTGCTGCCGATAGCAGACATTCCAAAGCGTGAAAAGGCTCGAAAGGCTGTCGAACATGCCGCG
CTACGCATCAACACCGAACTGTGTGCACTATATCGCGGGTGTATTAAGGAATCTCGTCGATCCGCAGCTTCGTCCTCTAGTGACCCAGATGATACCGGGA
CGCTACTTGAAATCTTCGAATGCCGACAGCTACTTTCGCAATGTGGCTTCTACTTTACCAGCGGACAGCTCGAGAGTATCATGCAGGGCGTTCGGAAGGC
ACAGCGAGCGAGTGTTTTGGCTTGTGCATCATCGATGAACATTGTTGACAATTTTCTGGAAGACCTACCTGCAGAAAATCTCCTTAGACACCCCGTGGAT
CCAAATCGACTTGAGGTCGTGCCTTGGGACCAACTGCTGGTGTTCCGGGAAtttgtcgagctgctcgttcgCATCGCACATTCCTGGGTTACGATAGCAG
AGGCAGACGGCGTGGTCGACCTCTCTGTGCCCAACGACAGCACGATATTTCTTGCGGACGTGTTCTCCGATCTGTATGATCAGATGATGCTCGAGCGTCT
GAGTCAAAGTTCGCCGTCGTGGTTAACACTTCTGCGGGCAGAACTCATGGGTAAGCAGTTGCATAGTATTTTCACGAAGCACCACGATCAGCTTCAAAGC
TTGTACGGCAGTTGTGCAGCCCCTTCAGTTCGTCGGCAATCCGAAGAAGCATCGGAGCAAGAACCTGAGGAATACGAGCCTCACACACCGATAGACAAAC
ACGAGGACGACGTGTCCATCCGATCCGTGCTTGTCATGCTCCGTAATGATGTTCCTGCGGCTGCACCTGTCTTCACCGCGGACTTCCAGATCCACGATGC
GCTGTCAGCGTTAAACCGAGCTTTTGCATCGTCCTCCCCACCTCTAAAGGCCGAGCTGCTCCGCAGTGTCGCTGGGTCCCGCTCTGGCGAAAGCAGTCTC
GATAGCGAACCGGATGCTTTCTTCATGGGCACCAGGCTGGTGTTCTCGGAGTTTCTGGATGCAATCGCCATTGTGCTTTTCACAAAGCAGCACATGGCGC
TGGAGCAATCAACCAAAGAGccgagcaagcagcagacaccTCAAGACCTTCCTTtgcacgtgctggtggatcaaTTCATGCAGTCAGTGAAGGTGGAATA
AACAACCCCAACACAATCCTAGAATCCTAGACACCCAATTTCTAGCGCGCATCAGTAGCAATCTGCCTTCTCTTCTACGTCACGCAGTCTAGTACACACT
CCCCACGGGGCCCATGACCTGGGCGTACCGCGACGGTAAACTGACCACTTGGTCATCGTCAAAAGTAGCTTCGAACACCTGGCCATCATATGCATAACGC
ACATAGCTGCAATTTCAACAGAAAGGAACGCGTTAGTGAGGTAATGCAATCACCAACCACAGCAAAGCCCAGTTCAGGACACTTACAGCAACGGTTTAAC
AGCAGAGCTTGATGATGATCGTGCATCGGCAATTGTTTGGTCTTCGCCGATGCACGGATTGTAGAATCCTAGCAGTCCGgccttcgacgacgaagttAGA
GCGAGCTCTCCGTCCTGAATGCCGTCAAAACAACATATCAACTCGGTAAGTATACATGATTTCGTAACGCTGACACACCAATTGACTCCCGTaccttgac
gaagaactgaAGAGGAATTGTAACATCGATCCACTTCTGCCCCAACAGCTCGGCATCCGCCTCCTGTTGTGTAATGCTGTCACCGCTGCCAGTCTCGACG
TCATCGCCAATTTCGCGGTTCAAATCCCGCTCCCGTATCGCTCGGAGCGCCATATCCAATTCCTCCCCTCGAGCATCACGCGAATCGGGGCTAGTTGGGT
TCTTGCCGTACCGGCCCAGCAAAATTACCAAGCCCTTACCGTCCtctcgttgctgctcctgttccGTCTTCCCCTTTGCACAACGCAGCATcagtttctg
ctgctccagtgcaCCCTGCCGTGCAGTAGCGAGATACTGCACGCGCATATCATGTcggtgctccagctccagacgACGCTTGCGCTCCTGCGCAGGCTTC
ATGAGCTGCGTGACGACTCCCGCTACCACAAAAGGCGAGGTGGCTGCACAAAAGGTAGAGAATGCTGACTGCGCGGAGAACGGCGACAAGAAAATGGGCA
TCACAAAGCGCACACTCCCGCGAGTGAAGCCCAGACGCAAAGTCACACCTGCGCGCGCGAGCAAGACACCCAATCCCAGTCGTGTACGGTTCGAAATTTC
TCGGCTAGCTCCCGCCACGAACGACAGACCCGTCGCAAGGCTTGCACGCAACGACAGTTTGGCCGTCGTCGCAGCCACGAGGAAGCGGCGAAACTGGAAC
GTCAAGTTGGGTCCACCACCATtcactgcaacagctgcCGTGGCATTGTACGTTCCAGTGTCCTGACTGAGCGAGGCAGATAGACCGTCCCGCGTACTCC
ACATCATAGCACCGTGAAGCTGAGGTGTCAGCAACTGGTTAGCACCCATGGAGATGTCCAGCCCGTTGTCGTCAAGTTCTGGAATGAGCATGAAGACCGT
GTGTGGCGACACCGGCTGACTGATCTGACAATGAAGCTTAGGCGCCCAGCCCAGCTCACTCATGAGTGTGAACGACGGAATGCTCGGGTCGAACGACGTG
TGCGCCAACTGCGCCGTGAAGCTGCCCATGCCCAGTCCCTTCTTGTCGTACATGAAGCCCCCAAGTGTCAGCGTCGTGCTGCGTGACAATGGGAACGCTG
TACGCTGGTGGATCGTCATCTCCGTGCGCTCTACAAACCGCGCACCGCTGTGGAACAAACTGCGCATTCCCTGCATTGGCGCCTGCACGAAGTCAGACGC
GTCCACGTGCATGGACATATCACTGAAGGACGAGAACTGCGCCTCCAGAGCCTGCTGGTTCATGCGACgcatgatcttctccacgtaCTGCTGCACTTCG
TCCGACGTCTTCAGATGAGCCCCCACCACCTGCTGTCGTGCAACGCCATTCTGCTCCAGTGCATGCACCCCCTGCAAAAATAAGTTAAAAAATAAGTACC
AGCATCAGTCAAttgaccacttcaacatgaacaATTGAAAGAGACAccccaaaaaaaaactacTATCAATTGATAGAGTCCTTTTGTG