Description :
From Genome Similarity Track
Location :
Scaffold_246:12787- 13847
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_246-fgenesh-gene-0.8Ribosomal RNA methyltransferase nop2
Pytve_DAOMBR484maker-pve_contig_246-fgenesh-gene-0.1Antigenic protein

Sequence
1060 bases(100 bases per row)
AATATGCTTACCTGTTCTGGAAAAACTGCGCTGGTAGCAATACACGGTGGTTTGTTTTGAGCCTATACAAAAACGAAGTTCAGAAAAAATCGTCTACTGC
CCAGAGCGACTGCCACCCGCGATTTACACACCCCCGCAAATGGATAATACATCACAGAAATTTCCATTTGTGGAGGATGTCTAAAGTCGCGTTATGAAGT
GCATTTTTTCAAACACATTTTCAAAAGTAACGATATAAAGTGGCACACTCAAACGACGTGCAACTTCAACTGCCAGTCGCCAGGTGCCGACACAAGCAGA
AATGGACACCGGCGCCGCGCCTGCTGGGGACACGCAGTCCCCGCTCAGGCACGAAGCAGCCGGGCCAGCGTCCCGATACGACGCGCTGCTGCGGCAGATC
GTGCAGCTCAACGCGGATCTGCACAAGACGGCGGCGCTGAGCCAGACGCTGCAGAGCGAGCGCGATGGACTCCAGCAGAACAACGTCAAGGTGCGGCCAG
TCAGTCAGGCTTCTCGCTCCTGAAAAGGTAACAGGAACCATGGGTGTTCTCTTACGTGTTCATTATTCCGCATATGAAAGCTCAAGGACGAGGTCAAGCG
GCTGCACGAGCGATGTGACAAGCTGCAAAACGTGCTCATGCAGGAGACGGAGCAAAAGGTGAAGCCCCACACGCAACGAGTCTAGACGCGGCGATTCTAA
TGAATACAGGAACCACTGCTCTGACTGTGGCAAACGGAACGTCTGCAGATCGAGTCGGACAGGAAGCACGAGGAACTGATTGCGAAGTGGAAGCGCCAGC
TCGAGGCCAAAGCGAAGGCGTTCGAATCGCTGCAGCAGAAGTTCGCTCCGCCGCGCGACCTAGAACAGCTCCGAATGAAGATCCAGGAAGAGCTAGAGGG
ACCATACCAGAACCGAATCGACGGTCTCCAGGACGAACTGGAGCGACAGCAGCAGCGAACTTTTGAGATCCGGCGCGAGTATGAGATTATCAAGACCGAG
TACGAGCAGTTCGCGATCGACCAGGTGCCGACCACTTCACTAGTGCGAGCACTTTTTCAA