Description :
From Genome Similarity Track
Location :
scaffold_35:127831- 128857
Sequence
1026 bases(100 bases per row)
GCTCACATGCTCTGTCTGATCATCTTTCTGCGGGAGGCTAGCGATAATCATATCCATTCTGGTGTCAAGCACCTAGAACAATATTCACCGAAAGCTCGCT
GCAAAGCGCGAACATCTATCCGATACATTGTCTTCAGGCGCACCGTGTTGGCAAATGACTTGTCGAGGAAACGTATGGCAGTATGCTTATCGGATAAACG
ATCGTTGACAGGAACAAAATGAGCCATTCTGCTCATGCGGTCTACAAAAATCACAATGTCGATATTTTTAAACGCGTCTTTTGGAGTTGCGAGAAAATCA
TAGAAGCAGACTGCCAACACACCGTATGTGGCAAATTCCAATAGTTGAAACATTTACCGCGTGCGCACATACATACATACGTGTTGAGCCTCCAAAACAT
AGTGACCACCGGGCAGTATGTCTAATCTCTACCGATACGCCCATACGaccacgtgcgcacatacatTTATACGTGTTGGTCCACCAATACATAATGATAA
CCGGGCAGTATGTATTGTTTCTATCGATGCCACCATATCATGTGCCTCACATATTTGAAGTCCTTAAGGTGAGGCATCACTGCGCGCTGAGTGTCGTGTA
GGTTCATACTCAATACGGCAAGCGTTCGATGATGCAGGCATGCCATCACACTCTTGTAAACAGCGACATATCAGACGCATTGCTTTAATAGGCGTTCGGC
AACGCAGCACATGTCGCGTCTGACCCATACGCTGAACGTATCGCCCCACCTTGGTGATGTCCCAATCGTGTCATGCAACAATTTATACTTCAATCGACAC
AAAAGCGCATCTGCCACCACATAAAGACAACCCAATGTATATCTTACCTCAAATACATACTCGGCGAAAAAAGACATTTGTCTTGCTATTCTCGGTGAGA
GATGCGGTGACGACATCGTTGTGCGcgacgacgcatgatctatatAAATCAAAAACGGCTCAGAGACAAGCAAATGTACATTGTATTGACAAGATCATAC
TTTATTGCGTGTAGCTTCTTATCACG