Description :
From Genome Similarity Track
Location :
Scaffold_65:127824- 148514
Transcript NameFunction/comments
Phyca_LT1534554825conserved unknown protein
Phyca_LT1534554827nucleoredoxin, putative
Phyca_LT1534530463phosphatidylinositol kinase putative
Phyca_LT1534510702myb-like DNA-binding protein, putative
Phyca_LT1534126822cryptic tubulin

Sequence
20690 bases(100 bases per row)
tgagatgcccacgcggtgctgttcgtgacgacgtggatccgatacttcgccgccgccatgcgatagtagccatatgctgcgctacagtgaggtcgttcgt
tttcgcacagtttttcactagccaagcgccgccgctacgcggcggtggttttatgtattgtcgcagtgggagggccacccgccttcgctacgcttcggcg
ggtaaaatcgaatctttacgtcttttaatgcgtttaaaccttttaaacagatttttaaacaccaaacactgtaatgaataaaaattgacactaaccaaac
ttactaacgttttggatttttcctatttgaaacttgcacgccttactcgctatccttctcacatacacattctccaatgttcaacataaagagttactta
cgcttccccgtgtaggttgcgcatcattttttgtatacaccccttcaggagcttccaactccgggtagtctaccaacaccttaactttatcctcacggtg
agtatggaaagtgccacgtactattggtcgtcctcctccaaatccacagatagaaactcgcaggaaatcgcgagaaatttgtgacaaaagcatcatagat
acgccgtcgttccgtgtcgctatctagctatacattcatctctagctctacatgtttcatgctaaagatactcatcggtgtgtttatcgctgtcccagct
cgcgcatcctaaaacaagtactagacgagcatgctgtccgtccgtccgtcacgcaaaacggtgatcgctgaacgcgatttgattggctaaaattattttt
gccgtttactggatgctgattggatgcatcccacctattatataacatttgcctattgttaagaatactaaaattacaaatataaaacactaatggttag
gcttcctgcgattggctaaaaaaccgtcgctgccgagcgaagcgaaggcggccccagttagcagtcttgcggggccccaggcaagctaccgttgcgcagc
gaaaagattcactatcgtgatatcctaaaacaagtactagacgagcactgccctgtccgtccgtccgtcacgcaaaacggtgatcgctatacgcgatttg
attggctaaaattatcgcagctgaggatgctgcgtggtagtgacataaactacagagcgagaaagacacacggaaatagagagcgatgcgcgagctggga
tagcgataaacacgccgatgagtatctttagcatgaaacatgtagagctagagatgaatgtatagctagatagcgacacggaacgacggcgtatctatga
tgcttttgtcacaaatttctcgcgatttcctgcgagtttctatctgtggatttggaggaggacgaccaatagtacgtggcactttccatactcaccgtga
ggataaagttaaggtgttggtagactacccggagttggaagctcctgaaggggtgtatacaaaaaatgatgcgcaacctacacggggaagcgtaagtaac
tctttatgttgaacattggagaatgtgtatgtgagaaggatagctagcaaggcgtgcaagtttcaaagaggataaatccaaaacgttagtaagtttggtt
agtgtcaatttttattcattacagtgtttggtgtttaaaaatctgtttaaaaggtttaaacgcattaaaagacgtaaagattcgattttacccgccgaag
cgtagcgaaggcgggtggccctcccactgcgacaaaacataaaaccaccgccgcgtagcggcggcgcttggctagtcgctctctattttcgtgtgtcttt
ctcgctctgtagcgcaaaacgnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnncgatttgattggctgaaacgttttttttgtgttttacctaaatcaagtggaatacattagccactgcataatttctcgc
tgccgagcgaagcgaaggcggccccagttagctgtcttgcggcccccacgcccgctaccggtgcgcagagaaggtatttaagcccgtggtattgcattca
cctcctactacaaaaaaatgcatcnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnatttggcttgatttaattggctagatagtaaataattgcatttcaatcctacaacaagtactagacgagcatgctg
tccgtccgtaacgcaaaacggtgatcgctgtacgcgatttgattggctgaaatgttttttttgtgttttacctaaatcaagtggaatacattagnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnttccgt
gtgtctttctcgctctgtagtttatgtcactaccacgcagcatcctcagctgcgataattttagccaatcaaatcgcgttcagcgatcaccgttttgcgt
gacggacggacggacagcatgctcgtctagtacttgttttaggattgaaaattttatcgacctgcatttttcaaaacttatgatatgtgaatacacaggt
ttatcgaatgtgaaggttcttttaagcaaacaatgtatccaaccttatttgaaatagaaatggaaaaactctaataaaaagatatcgaatttctcaggtt
tgtaaaagttcatcgactatctttttcagcaaagggacgacggaacctccatactgaacgcaagtggctccccacaatacgttacaccgtacggcaggca
gaagagatggaggcgtcggccagcgcagcggagagatcagcgcccgtaaagccccacgtacagtcgcctcgtgacgttggagaacccacagccgcagcga
tgagtccatcaactccgactgagaagtatgagaccgaggtggaaacggagaagagccccgtggcgaccctgcacaagcctcacgaggatggtgcagagtc
agacaaggctcggacagacagtgacgacgaagaatatactgttgatgctgtgcaggagcctacgacacccgttgaagctccaaagacgccagttgaagag
ccttcgacccctacagatgagcacccagagcctacgacgcctgtagagcaacccccagagcagaattttgaggacgaagctgtccctgtagctgtccatg
aagtagagctgaagatgcagtcgccagttaatggcaaagatgccgagcaggtccacgagcttgagttaaaggtacaggaacaggtccaagagcatgaaat
ggaactcgtgatcccgtcgccgaaacgcccgactccgttgaacttggtgcatcacgatattgacgacgaggccagcgatagtgacgagatggaaggagca
gttggtagtgacgataacgatgaaggtgctgatcttggcacacctctaggctacggtggtgctgcggatttcggggagggtcaagacgagtttacgtcgc
atcgcttcttaggtcccagtgtggcttctgacccctcgtcggcgcgcgcgctgcacagtctgcgtcgtgttgcacttcatgccaagcctcctcgttttgt
tagcgaagcaccagtcgttgcggcgagctctggtagtgtgacgagtagcggggagtcatcgggacggaattcgtcgagtgcgagtgcgattcatgctcca
gatgcaaaatctggtctgcgatcacaatcagaagctgactatgtggaacaccctctcaacacgtacactttaacattcacggagcaggtgctggggttca
acacgaatgtcgtcgtctcgttggagaatgaactgcttgttgaggtctggagtgtggataaggacagccctgcgcagcgtggcggtgtggtggtgggtga
ctgcctgattagcgtgaatgggcagcacatcgaaccacacatgactaaggagcaggtatttgagattattcaatcgtcgacgatcccacgtacacttgtt
ttccagcgggacgtgcacgataaggatggtgctcaatccaagagccttcctgacaagaagcattcccctggaaagccgcttatgggtcgtctgggtgcag
ccatgagccaaggagcgtccattatcggctctaaatggaagcgcaagaaaacgatcgtgcatcagaattcgttctgcgatggctgcggtatggatccgat
cgtgggtgcgctctggacttgcagtgtatgctcaaattacaatttgtgcagtgaatgctacgacttgggcacccatggtatggagaattcagagcagatg
caggcattgagtgaggccattgtgcagtataaactacagaagaagtgcaagcactttacagacgagttcctcttatcgcttcgccgcgacatctgcaagg
gacgaccagacaagttcgaatacctgggcgagtggattgccaacatcgtcgtgggtacttctgcggccaagattacagtgcgcggcatcgaaatcccatc
tcttccgcctacagctcgccaacgattcgtgtcatacctcatgccgttggtatcaaacagaaccgacattgaagtgaacattgagtggctaccagatgat
gccgatcatattaatgctgccggccgtgcaagtgtagatcgaatgagtgctggtgcgtttggcagtggcgacgaagaggaccatagcgtttcccctgaga
acttagagaagttgcgcatctggatctctgacaagaagacacgaaccacgtcaccgtttgcctgagaaaccgagggtggttatttgcatgtggtgatgtg
agatcaggcaggtgacttcagtcttcgagctgatgataacgcgggtgcaacttaagtcatttatcaagtcctacctagcgaggatagcacccgtcaaaaa
atagttagagatcttcttttgtactttgaagtgtactaaaaaaatctgtagttttcactgagactagtgtagccatgtttgatcttctaacaattttttt
ttaaatatatcagttatttgttgtaataacctcaacattcaataaagaacgaaatataaattatcaaagatctaagtgtgtggcagcaaagacgtcctgc
aataaccctcgcaacttaccgaccggacatgatgctggcctcgctgcgctctcagatgggcgctctgacgctccgcccggccgcgggcagcgtcttcatg
ggacgcgtgacccgagtgacactttcaacaaccgctgttgagggcgaaaacactgcgtcggatgaggacacggctgcgttcctgagctccacgtcccctg
tggagccccgcaccgtcaagactgtgaagcgcgccatccgtgccagtccccgcaagctgacgtacctggcccagcagattcgtggactttcagccaacga
ggctatcctgcagatgaagttttcgcccaagcgcaaggccgagatcttccagaagacggtgcaaaacgctatcaacttagccgacatcaagtaccagatt
gagcctgagaatctcaaggtggccgagtgcttcgtgaacaaaggcacctacctgaagcgtctgcggatcatgggccgaggtgcgaactttacagtttttg
aggacgaaatgtgatatctaactgcttattgctgcatttcaggacgttcgggtgtgatgcaccatccgcacacgcatcttacagtggtgctgcgtgagtt
tgacccgtccaagaagccgttgaaccgtcacatgacgaagaaactggcacgcgagaacgccaagaagcagttggagaaggaagcgactgcagaggaatag
atagagcggcccacagacgtgtacccatcctacaatcgagtcgtttggtcgaaatggggacgttttgcagcgtgaggttgcttgcgagcaacatctccat
aaacataggaatgcactgctttttttcgtacatacacacaggaggtggcctgcttggcggtacgcatttttcgtaaacagacaatattttgtcgctcacg
gtatacctcatttagtcatttgtttcgtaagctgagattacgaacatggagtattactattattcactgtttccttggactgtttccttggatatcaatt
cttcttctcactttatcatttcctatcgaccccaacaagagcctcgaagcaactcatacagtcaacatgaagtggtcggaacagctcggcgctaagcttc
tgacgaaggacggccttcatgacacggacaacaagctggccggcaagaaagtgataggcttctacttcagtgcaatcttgtgcccgccgtgccgccagtt
tacgcccttcctcagtgctgtgtacgacgatatggtcgagcagcaccctgagtttgagctcgtgttcatctcctcggaccgtgacccgtcgcagtacaac
gagtacttcggcgagatgccattccttgctcttcctttcgacgagcgtacggttaaccaggctatgggagccaagttcggcatcacgggcattcccacgc
tggagtttgtggacaacgagggagaggttatcaccctcgacggtcgtagcgccgtggttaactcgcgcggcgacgtggagaagctgtggaagcagctcaa
taagtaaaaagatcacagtgttgtcacttgacagtgctttcgttttctaaggttttgcaaaagaggttttggtagaaggcaaagagtagaatgtgcaagt
agatttactaattttaatagatctacctgccgttggcttctgtccacttctagtattaataacctccacttttttctctttgcgggggaaatctgtacta
aagctaactgtaccctcaattgcaccccatcttttcacaaaccacagggataaactcaacgagttcgccgctacttcgaagtactgtagcagtgacagta
acacaataatccacaaccttgttacatgtattattataaactttacgtacattctctggattttatccagagatggcaataaggtgagattcttgtgttt
tctaataccttgattaatcgcttgagaatttgtttgttttggtgctacgtgtgttagtacaaattaataacctgttggatttttgtataattcgtggatg
ttgacccctttaaaaggccagatcctgtacaattgtcctcgaaatgaggacattttgtaacgtgagctaggtgacatgacacgacatgaccgtagtgaag
gaatgcactgctatttttcgtacatgtataccagactattatacatgtcatgtacctcattgggttgacatttcctacccagattacgaaacattggtgc
tgtaccagtccaaaaagccgtgacacacacgtggcagaaaattcacttggattcgttattggcctcaactcgtattattctgtctctcacagtactgatt
ccttagatacaatcttcttctcactttatcactcccaatcgaccccccagtaagagactcaagcaattcgtacaggcaacatgaagtggtcggaacagct
cggcgccaagctccaaacgaaggacggccttcaggacacggactacaagctggccggcaagaaagtggtaggcttctacttcagcgcgcactggtgcccg
ccgtgccgccagtttacgcccttcctcagtgctgtgtacgacgatatggtcgaggcgcaccctgagttcgagctcgtgttcatctcctcggaccgtgacc
cgtcgcagtacacggagtacttcggcgagatgccattccttgctcttcctttcgacgagcgtgcagccaatcaggctctgagcaccaagttcggcgtcac
gggcatccccatgctggtgtttgtgaatagcgagggagaggttatcaccctggacggccgtagcgtcgtggctaactcgcgcggcgacgtggagaagctg
tgggagcagctcaccaagtgaagaggccacagtgttgtcgcttgagttggagcgacagtgctttcttttccagagcttttgcaaaagaatatgatttttc
cattcttatgataaagtagtactggcacgttcttggggttgctgtgcttttgtttgttgcgagcgtcgcagacttctgagcagggagagctttgactcaa
tggatacgtctgggttatggaaagcattgtgtttcggagctgacgaagatgtgaagggagtaccgctagcttcagttgtcttcgagaggtcagggtagag
cctgactcctgcaccaccacgcaaggccatgacgcgtcgagatcttccggatgaagggtctgggaatatgccatgcagcactgagctcgtctggaaatac
tggtcgcggaggtgccgctgccgacgtgcatgctgataggtagacgttgctcgtgcttggccagcttcgtgcgttgtctccagtgcagctaggcgactcc
agttcgcatcgggatctaataattgcgagatccgagtgtcaagagtttgaagcagtagagtcatttctgcctcagcacaagagaaactcattggatactg
caggcgaacaagcgtctcgacgtctacacgtagggcaagcagcaacagcggcatgagagcattaagttgccgaatcgaacgctgctttcgctccaatttg
gatcggagcatagagaaattctgcgcgatggagacaaacagcgcgtcttgctcggtgttgactcgcccctgttctctagttgatggcgtgcacatcaccg
tgaaaaagagatatcgaactgtactctggactagctctaccattgcggggcttgtcagagcctcgtataacatagttcgtgtgccttcatcaccctcaga
caagcctaacaaggctagaggtagcgtgaggtagaactcgttgtgcataacattcaacgtcttcgtacaggcttcaggagggactcggcgctcgtctaca
gatgtgcgccgtcgctgtgcctcccatttggcgatagcgccaagagctactggtgagccaggcgttgtattcaatgctgattcctccgcctggtttaacg
ataacgtatcgattaagtcaggaccggtctctgtgcgagttccgtaaagctgcaacacgtcagcctgtggtggcggtgaagccagcttgaacggcagcag
aaatttgcgtttcatgtcatcaaaggaaaaacacaccgtaccaatttggtaaagatgctgcgcttgttggccgcgaagcaaccgtcgcggcgataacaat
gctaccatgggaatagcatcacccgctttctctcgtttaattcctggtctccattctggcttgactggcgtttgtcctgcttgagtaagagctttcgggt
tcaaatcaatcgccaacacatcagacaatgatccacgggacttccaagcggatgtaacagtacatttctccaccggaaggtgttgcaagaccagagcgat
gttctctggagtagaattagcaccaattccttgcaagtagcggatagcaaactcgtccttgactgcctgggtcagtcgaggaggtgcagcagttggagtt
tgctgcggtttgagcggtatggtcacatgcaatgcctgcacagcagtaggagcatcgacagtatcttcctgaacgaggagagctcgtcgaggtcgagctg
gaggacgcatgatcaattgtccgatgttgaagtgcttcaaataggttgtcgcttttaccattggctggaaaccaacctattctgatttgccaaaatacaa
ctttgaattttgaaaacgtctcccgccgccccaattccgcaccagcatcgtctcgcctaaaatggccaagacaccacgccccatgtatgatgaagaccca
gacgccctgtaccgaggcgctcctacgcgtgtacctcgtgtacgcgcaatttcatccactgaccgtcttttaaaaccgacgaaggcttcactggcaggag
ctagaaagaaagtgctgacaggcaaggataaggagctggcagaggcgcgtgagatggcgcgtaagcggcgtcgcctagcgcgcgtggccaaggagaacgg
acgactgacgattccacagtcacctaaattccacaagctcaaaaagtctgaccctcgctcccgcgccgacatgttgacgcggacgtctcgcgaactgcta
gagatcgcggccatccgcaaacgagtacaagcacaaaagcgcaagacgaggaagtatcatgacgctaccacacacggtacagcaccaggaaagagtgatc
agttctcgcaagctctttcagcaagtggaggcgtcggagtcccggctgttcgacgtccgaaactcacgacgcctgtgggcttcgagtttgaaatagacaa
gcgtgcggcagcggcagagactcgttagagtcttaagaggagaagcgtggcggtaacacagcatgcagcaatggaggagaaaggagatgtaagtgcagag
gagaagagtgaacagccactcaaacggcgaaaatcggctgcagcatgagtttaagacgaagtgtgattgcgctgggaggcaaaggaggtgtcgtgatctg
cgtgctgtctctggtggactaatgatttaatgccattttatagcttaccgtggttgactcaatggctgctagcatgacactgtacttcgcagatcaacgg
tccctagcatccgacaagtgagatctggcctacatttacttcgaagtgtagctgaaaagtattctcgaccgcgttgagactccagttgagacaaaggaag
tcggccgccgcgacgtgacaaacctcgtccgtgatctggtcccaaattgtgcgtgagcgctccggatctgaatggtttgcacttggcactgtcaagttgg
cagacggctcagatggacagcccggcggtcgggcttccgactcgggaagcggcagcagccgacccgcacgacttttaagtcttcaagcgtgatcagcagt
tgctgattcagtgccgaacctccccgaacttgaccggcgggctcgaaaggctactttttcaaacggataatgtctggcttgcatcgctgctggatccaca
caaggcaacatgcagttgtggcgtacaatagtcgtcaggtgagtccttgctgctactgtgcagcttgcacttcgttacagaccatcatttaccaccctac
tcttctacaatgagcatgtcgatgtatcgcagcgccgactacatttcgagagcggcttgcatgtgccaccatgaaactgctaggggttcttgctgctcgt
tcaccttggcatcagtgctctacggcgaaggctgatcctgtcgcacgcagccatgatagcgacctcggcgtccgaccgcagccagcatcgcatccgcgac
gtctagcggcaccagtgccgctgcgttatagcgtcacttcagcggataccacaaatttttgtgtaggcccacaaaaaaagatttttggtccttcggtgat
gggcacttcgcgcgtgaagacactgcgaacgctggtgctcaaagtatttcgaattatacacacatcaagtcagcagcccaactgccgacgaacgcggacg
aaagttcgttcgatgaactcatcccgtcgggtcgggaagggcaagtgagtccagcgcacagaaactcggagtaaacgccgggcgttagctccaattgcct
gctttcctacaagagctttatcttatctgcacgtgtggattctgcaattcgtagttgactcaactacgaactaagttgaggcattcaacttgagagttgc
atcactacgagagctcgcagccagcggctggcctagcccacccaagcaggagtacaggaatccacttaaaaatgtatagctacatggcgagagcgcatgc
atgttcggtcgagctttccttggaagagcaccgcgagcgtcgcagaacgcggccgcgcttcccaaaagcggtgttgtggcctcatcacaccgtggaaaga
agaaacttgcatgcacgcctcctggtggaagcgacggcggtgtcgcatacacaaccagctcaccgagcggagtcagcatcaagctgatgcccgcttgatg
cagaccatgcaactctgctggactaaaaccatgcgagcccggcgcaagcgaaaggaggaaaaagaagaggctgcgaaaggaagctggccgaagcgagcgt
catgttcgcaggccgtactgaactgggacgacgccagtagtgtgtgaattcgcagcagtgccgttggtcaagcgctgttaaaaacagatttattgtacag
tatagtcaacttcaacgcctgcgaccttcagcgcggagaccgatctttttctggatcgcagcaccgccaggaaacaacacgcggcactacgctacagcat
attgcgacacgcacatgctaaaacgaaggataagcgaagttatttattttattttccgtacacaaaatgtgccgagattttgctgtgaccatacaaggca
cctgattttatttttttcgccgatgttgcggtcatcagcaggcaagattcttgcatttccgaggctgtcaccactgcaagtaggcatgcctcaaagctaa
gagacagcagacatcgggtcgcctgaaatgctgctgtctgtgcgattagttaggctgttccaacagacagcaatcacttcgagccatgctttttcagcat
ctgagctgaggtggcaaggtgatgtagagccatccatacggtggcgttgcctctatagtagagatttccactctcagaaaacaggcgagtatgaggaaaa
tcgacgcgaaaataaaccgttggggcctttacgctttacggccttaatcgccaaagcacgaagttgctatatgctgtccatacttctgttatcagctgag
aacgcgccgacatgcatgttgcgttggcgtggttctgtagtggttgtgatgcagtgtttatatggcaaagcaaactattggcatttttgcacaccaaacg
aaagcaactgcatctctcttgagtcagagtctgaccaccgctcttggatagcctgaagtgagccgcaactaaccagcttgtttttgcagttcgcctggta
tcgcgactactgcacgccgcagattggagcaaaagctgttttcagcattcaagtgtacgcactcaattgcgttgaccaccaggcaaattgcgtccccagc
ctgctggtggtagttctcactccccacagcgactttaatatggccttgtaaattaccagcgataattttagcgggcattttccatctgagataccgcagc
gtactgtaccggaactgaacagacgagccggtgggatacccagctgccattggtcaatcttttcgctgaggaccgctctgagccataatttacccctacc
ctctttcgcattgcccatccccccttttcgcccggctagggccaccttcgtgtcaaaggcgaagccaagctaaaaaagtgaccagcggcctccgcctaat
cacatcaatcactcggctccatttccgatttttgctcgagccgcgcactccgcagcaccaacacagcaaccatagcaactccaaccgccttaatgatgat
gccttccaacagcctcgtcgccgctccggcgccctcgacgccgatcacgcgtggactctggtcagagcaggagcacgagcaattttgcacgccatgaaaa
tgttcccgactggcccgtggcgttctattgccgctttcattggcacgcgctccatcaagcaggtgcagacgcacgcgcagaagtaccagcagaagatcaa
ccgtcgccgacgtggtctacgtaaacagaagaagaaattcgttcgccccgagcaccgcgtagacgcccatgccactggatgcatccagcgcgtgaagaac
tttacagtacaaggatcgccacgatctccatcggcttttccaatcggcgccatgtccccaatgagcggtggatttggacaactacttacaggcggttgca
gccctgtagcaagtgatgatggcagttgtaccagcagttttaccgctttagacttggatgtcgacatggactcattgctgtgcgatctggaaccgctgcc
gtacacgcccggagtgtcgttcgaagacgttctgaccgatgacgcctaccgacaagacgtgcaggaatcagtcgacctgcttcttgcctaatttattgcg
cctcagcggcaatccgtagtaacacctcaaaagagaagtccaaccaggccggaagagccgagtgcaacgagataatatcatttatacgttttatcttcct
tggcagtatttgtgtgggcgatccgtgccctgatagacacgtgctcggtggcaacttggttgctgaagaagcaagtggcttactagccttactaaaagct
gcgtgcttttgaagcggcagtttagagcggtttcatatcttcaaccttagtgctttggagcaccatgtacgacttgtgccatttactatagtacattaca
gtaaatggcacaagtattttacaagctttaaaaggctggaaatgtctccattggaaaagcaggcttctatcggcaacgcaccagattcgagacgagttgc
tcgacaaatcgtagcagctgataggataagaagaattgtggtttgtggttattatgaataatgttatactgcatgtgcctgagtgcatcgcatgttttaa
tcaacgtaggtgtgaatggtggaggtaatgagtgtccaggatgaactagcaacgccgaacgagaagatgagcatataataaaatgataaattgcattctt
ttcatggagaattttacactattcggatcacagcactacgagcccattctgaagactgtacatcaaactgttgctcttcgatatctacatgcattgctct
tggatagccagctttaataagccaatttgatcggcctcttcgtattctagtacatacattaataatttgtatctgtcttgaatcgagactctcatgttct
taatgcaaagactcgacccctaatgtaacaatttaccgctttatgcatgttcgggtaaacctccactattgtacatgtacttcgtacaaatgtaagttac
atttgatgctctacaaacaccgtaagttaattatgtattcttgcctctacacgtactaattcataagctttttaattttaatcagctcaaatgttgaaac
gaaatagaattgtcgtcatatcattaattagtcatatgccgcgtatccatgcagcggcttactgtcggaatttttgctgacgctgtaagggcggaccatt
cgaaaccttcggactacaagtagtaaaccactgaagtgtgctacatgtggaatcggttatcgtggccattaagtcaaacgtagaaaccttttattgctac
ctaagtacatattgtaagtctacggaggagcttaaaaggcaattccaggtcgaaatcgtagtaagcttagtccattcatgcggtctgttggaatgtgtac
tttagtttctgtggagtcgttgccgtagaccctagaatgcttacatgtactcttgctgacgggtgtctacatagtctccagcatcaggttgaagatccct
tcagtgacgcttctcctcgaggacctactgtatgatcacaactaatgaatgcagcacgttacacaagatcaaaatacatggtaccgtgatccagtgcaca
atgaacatgtagaagactctggaccgtgccgcacaagtttaatttgcaggagcttcaacgcagcggcaattgttgtcttgactgaagactctccagtctc
cagacggtctggcaaactggagtccagtgcgcacgaattgcagacttgcagcaattcacatactgtatccagtcgagatgattggatgctctcgtgcatg
gagaagatggctgcaggtgatcatcgtcaagcagaggcaggaaaatcaatgctcacaatggcaaacttgttattcctctgtaaataagtacttggacggc
ctgactctgagaatcttgcatctattgtgcttgtacatgtagtgcaaggaaacccgtatcctcacttctagaaatgtatatttctttggcaacttcgtct
tcggaaggaaaaatgcgacatggcagcgccagtggcgccacgcaacgcgcgtcgacattggctcgtgtggtgcccaatcaaaagttctcgtcgtaagcga
aaagattggatgcggcaaagaacatcacacagttaggtctctcgatggctaggagtcctggcccaggacacttggcagcaattgcttggcaaagaccgcc
caaggcgctgtgccacagcgccaaattgcattgaagcttgaaggcacttggtttgccaagttggcgtgttttctctgcgcgtcgtacatgtagcgccatg
acagtggtggcagtcccactgacacttcattacgccagtgactatacgcgtactcgtttgaacttgaccatgtgcgcactttcctcatgctcaacgatga
aagtttgagctgccatctggaacgtgcaatgggcaagtactggtatgtactggtattctaaaaggatcaagcgaagacagctgagccggctacagacctg
cagaagctgtccgagctgcttcaccaacacagaagtctgtactgataaaagcttgcatcgcaagggctctttgttataaatatatgaagcctacctcacc
agaggtaggcttgacaccgaaacctcaccaaatatgacggatctatcccatctaatagcaaccgaggcgagctcaactgcaggaattatatcgacaggta
gtcgatcaggaagtctaatgactcactcacagtggggatatgaatgggatccaagtcgatatcatcgccaaagtccaagaatggcaacggcaagaaatcg
tcggtcttcatctctacatccgtgccacgcgggctgctgtgaggctcgacgggttccagcttcacgctcatgtttttcttttgcagcggctctaccttga
cagcgttagctcgcgaggacgacggcttcctacttgcagcgacgagcttctcggcagcgcaatccaccagcttgcacaactccatcgtgtcgtcatcaat
acggtgctcgggacgaactagtttcttcttagatttgcgtaagccgcgtagtcggcgcgacaccttctcctggtacttctgcgcgtgggtctgcacttgc
ctcacggagcgcgtggcgatatgatcagcgatggtcttccaagggcctttcgggtacagcttcatggcctcgagaaaacgaccatgctcctcttgggacc
aaatacccttggctgtaggcgaaatcggcttggccttagccttggtagccgaaattggcgaactcgatccagtggcaaccatgtgcatttgaaattagat
aatcagagcactgcaaatgagatgaactgcttgcagccgcgagggtcttctggacttggctcagacttgttcgctcgatacgaggcggatttgagaatga
caggactgatgatccgttcgtgctcgagcttgatgcaaccacgttggaggtcggcacgtcctatcaatggcggtagaaactctctggtcagtaaacagtc
ccgttcagccccggctctgggacctaccgccattcgtacttattgcaaaagttgagtgcgcccgatctgcttgctgtcaaactgcgcagtccgctcgccg
ccaccactgctttccgcgcagacagcagcgcgctgtcgtggaggcagttaccaccacgtactgtggtcaggcgggtcaacgcatgctggccagccgctgg
acttttggcaaaattaggtgctaggacagacaagctgacctgcaacgatcgctggcaacgtcgtcactgtcttaacgtgaagttacacactgttcaaact
gcaatcaaactgtctgactctgggttgttgccgtctcgatcgcaacggggatggcggccgatgattcccacacgcgggttgaagatacagacttcaaatt
atgaagtagtaggcactgcgaaacaacagaatcgtacaagaagcgaatttctcgcagagcgtgtcgcggaggtagatctgggctcataatcgttagatgc
cttcgcgatcctggtgtccactggccggtggcgtcgatacgccttattaccacgggcgctctccattacggcccgtaatttacgggccataagtgctgcc
cccaaacttccgtgcgtcaaaggcgattgtggagtgggatgctgcgcaacgacggggctgcttcgattatttcgggcgcgtcatatctacacttttgggc
attccgatgttggctcggctatggtagatacaacgagcaagtcttttatgacgctggtacagtatctgctggagctcgtggttgctgtttttatgagcag
gatgacagcttcaacaaccggcaccgcgatgacaacgtcgctgcgatgaaaacacggaaatgctcgtgacaatgtttcttgagagcactcgatctattgc
cttggtcctctgcctctcgatacttttcagagagaagcccagaacagcaaggtattttgggctcgcgccagcgtccatgcacttctgaagattctcctcg
tgtgaaacgcaaattgacagtcaacgacaccacaggacctcgaagagttcagaaatcgctcgtttactgagcggctaaattgtcttgcgtgtgcatgcag
acacaagttgcgaggctgtgagctgctgtacatgtaacacatagtctttgtgtacaacaatactgggaaaaattaggcactagcggacttcatcctccac
tgagaacctccaataactaagagacctattcagcacagtggcagcttctagcccctgccaggagtcctggaacttccagtggagaagcggacgacctccg
cttgtcacagataccactgctgtgtaactatgactaccgctgaaatcgtcgaaaactctgagcctctacatgactgacctccttttcgcttccaccaaga
cactgtccgacagggctgtccctccaagacagtctattgtggattgctgtccggtcaatccgtccacgttgggatttcccacggaatctgtgggctggaa
ttaagctcaccagtacgaaatccgctcggccggctgtgaaccgaataaaagctctagtggcctagactggacactgactcaatcggcagtctcaagcgaa
accaactcaatcgattttggatcgatttcgaacacagaacgttaaacttgccgtttacgccgtttaagcggttagcaatttcatttgtaaaaagcgcttc
aaccatatatgctgttcgcacacgcgtggcaatgcacggtccaaagcagcaaaagactccgctccaagctgcatgaaccaggaatggagttcgacgatcc
gaatgtcggtagagtgtcggtaggcgtggcagctgcgcaatctagagaagaatcacctgccgacatgtcgctacctacatgcactttttcatcacaacaa
tttgtgattcgcaatttgcgaatcgcaaagcgtgagcaaaatgattctctttcaccaggacgagctacggcccgtggcagcacctaacaggagaattttc
cttgccggtgttgagatacagagccctgtgactggaagccaccatagtgaggcatgacctcctgagcgcttattgccgtcgctcgaaaatcgcgctgaat
attgctaccattgtagtaccgaagtacctatttatttgcgaaatatcggttcagggcatgtggatgaccaacgacaatcgagcagtgagcagcggacgtg
tccatttttcactagcgctgccccggcacatgttctacggtttttagcatgcgggtctttgttgccgtttgacgaacagttatctttgtgatgcggccaa
cgataaatgcgacaaagtttccccatccaaaacaggattaccagaggcaagatcacctagcagtgacaatgaacaatacttcaaataattattccttaaa
aataatataaaaaaactgcaaaaatattttaggcaataattacactataaaaattatatttttatcacagcaaatgtttaacccttactagaggtaatta
aactcttgtaaaaggactgtcaattttgaagtgatgagcatccagcttcacatcgggcaatgtgggaaccagttaggtgctgcctactggctcctggcgt
ctgcgtcaagcgaacttcatgaagaaaatcgtaatcgagatggcccagttgtaaataaacacagttgccgcatgtctggagtccccattgtcgctctaaa
agggtcgaagacgcgcgcatcattatccagacacctattccatccgtctagtggggcagctcgatgtatcctcgtggactcggagcctaaagtgattcga
tctgtaattgaaaacgccactgatggtgttacaggctttcagcctgcttgtacccacgtggagcaagcaggacgaggtaataactgggccatgggctact
atggacctagacggaaggcaccagcttcagccttcacttcattgggtctagatggtcgcagggaactcgtggagctcgtcatggattcagtgcaaagtga
gattgaacttgtggactgctaccaaggcagcgtggtgatgcactctttgggtggagggacaggatcaggattgggatgccgagtgctgga