Description :
From Genome Similarity Track
Location :
Scaffold_350:12782- 13786
Transcript NameFunction/comments
g5988.t1hypothetical protein

Sequence
1004 bases(100 bases per row)
AAGACACGCGACGCGTTTCAAGAGTACTCGGGTGTAAAGACTGCGCGCACCATATCGAGCGCAAAGAGCAGCGCGAGCGCAAAGATTCTCGGGGATGGAA
CAGTTGTTCTGCGTGTCTGGACTGGTAGTGCGTGGATAAACGCGCGACTGGAAAACACACTGCACGTTCAAGATTTGAACAAGAACCTGTTCTCTCTCAC
GGCTGCAACGGCACGCGGCATGACCGTGACTATGGACAGCGAGCAGTGCGTTGTGAAACGCGGCGGCCAAGTGGTGGCGACGGGCAGGAAGCAAGGCAAG
CTGATGTTCCTCAACATTGAGGGCGGCGACGAGTGCCATGCGGCTGAAGACAATATGGATTTGTGGCACCGGCGACTCGGCCACGCGTCTTTCGGCACGC
TGAACTCCATGATCAAGGACGGGAAACTCAAGGGTGCGCTGGCAGAGCCTGGAACCGTGTGTGGCGTGTGTGCGACTGCGAAGCAGGCACGCAAGCCTTT
CAAGTCGACCAAGGAGGGACTCGAAGCCAGGGAGAGCGCACGCAAGGACACCACTGTGTGCTCTGATGTGTTGGGGCCCGTCACTCCTGCATCCAAGTCG
GGCTACAAGTACATTGTGAGCTTCATCATGATGAAGAGTCGCTTTGTGACAATCTACCCACTGCGCAAGAAGAGCGAAGTGTGTGAGGCGTTCAAGAAGT
TTCTCAAGGAGGCAGAAACAAGTGCGGGCATCAAGGTCAAGGTGCTACGCAGTGACAACGGCGGTGAATACTGCAACGCGGGGATGGTGGCTCTGTGCGA
CGAGAAGACCATCAAGCAAGAGTTCACGGTGCCTTACAACCCGCAACAGAACGGCATGGCAGAGCGGATGAACCGTACGCTGGTCGAAATGACACGCTGC
ATGCTGGAGGAGAGCGGGATGGACAAGTCGTACTGGTGCGAAGCCATCATGACAGCTGCAGACATTCGGAACGTGTTGCCTAACACGTCAAGCCCACACG
CAAG