Description :
From Genome Similarity Track
Location :
Scaffold_46:1278- 4243
Transcript NameFunction/comments
Phyag_g1131hypothetical protein PHYSODRAFT_477130
Phyag_g1132hypothetical protein PHYSODRAFT_474224

Sequence
2965 bases(100 bases per row)
ACACGGAGACTGGGCTCGGTATGAACTCGCGCAgtgctggcagcacgtgCGCAAGTCCAATGTTTACAATCGCCTCACAGATCACCACGAGACTCACAGC
GCCCATTCGCTGCTTCACGGCGAAAAGCTCGCTGACCATGATCACGGGCACAACGCCAAGGCCGAGCTGGTGTCCAGCATTGGCCAACAGCATGGCAGCC
CACCCAGAATCACTCAGCGCCACGCTTCCATCTTCTGCCTGTGGTGCACTTCTGGAAATGGATACCAGTAGAAAAGCGCAGGCGAGTGCTACCAAGTAGC
ATCCACACTGCAGCGTTGCAGGTCGACCTCTCGTATCAACAAAGTAGAAGCAAGCTACGACacccaacgcagcagcaactgcaaccgCCATCGTCACAGC
TATCAAGCCTTCctcagcaccttcaacgGCAACACCAAAAATCGTGAGGACGAACGAAACGTTGATGTGAGTTCCACCAACACCCCTGCTCCCAGCTTCA
GGAAGAGCCGAAGTGATTGCTGGTTCAAGCAGGAATGAACTCACAGCACGCAACGTATAGAGCGCAGCGCAAAGCAGCACCGGACGAAAGAATGCGCCAT
GGTGGCGCCGCTCtgtcgccgccagcaccttcgcgTGGATGATTGCATTCGTCTCGTCCTCCGCAGCACGCTCGTCGCGATCAAACAATTTGTATAGCAC
TTCAAAAGCAGCTTCCCGGTCGTCGTGGCGAGCGATGAGCCACGTTGGCGAATCCGGGAGCTTCTGTGcaaacaacagcagcaacaatgcagGAACAACT
CCAACCAACGCCAACACCTTCCACTCACTGAGGTTGAAACCAAGATACCGCCGACTCAAGTACATGAAGAGTGCCCCCAGTGCCGAGTAGATGATCCCTC
CCATCGCCGAAATGAACAGCTGCGCACAGATCACTCGTCCGCGACTGTGAGCAGCACTCACTTCCGCCAAATACACTGGTACAATGACGTAGATGATCCC
AgccgcagcaccaagcaggTATCGTCCGATCAACACCGTGAGTTCTCCATAAGCGACGCCAACCAGCACCCAGCCCACAATGAAAGGGATAGCTGCCAGC
TCCAACGTCCCTGCTCGTCCCAGTCGATCTCCACAGTAAccagccccagcagctcccaaCACGGTGCCAAGATACAAGCACGagcggaagaagaactcAG
CGTGCTCGTGTCTGGCTCGGAACACGTCCACTTGCATATTGTAAAGTCTTCCAGGAGAAATGGGGAACATCATCAGCCATGCACACGCCACGCCTGCAGC
CCCCATCGCGGCCACATGCAGTGCGAAGAAGGAATTCCGTTGCTTCGCCAGACGCTTTTGACGATACTCAGGTCTGCAATGAAAACGCAACGTCAGCAAA
ATGTGACAGGAAAAAGTTGTGATACATGGACTCAAGGGACGCACCGCGAGTTGATGGGGGTGCTCTCGTCGCTAGGGGATCCTCCTAATTCGGACGCGTC
CGATAGCTCCAGCGGTGCCGAGATGTATTGGTGCGGCACGAAGgcgaagtcgctgcgtggaGGGTCTCGCAGACATGCCACCAAGTagcgccaagtacgt
gggCGTCGACGAGCAGCCATCTTGTGGTTGGTTAGGCTAATTCTGATCTGGTGGTATCCAAATGTGACGCGAAGGTATCTGATAAAAGTTTTCGAGTGGg
ggatgttgaagtgaatcTATGTGGGTACCTGCTACAGCTACGAGGAAGTCGCCTTCGAAGCCTCGTCGCCAAGACCAGGGTACTTCTGCGTCAATTCGCT
GCCTAGATGTTTCTTCCAGCGGAAAACGTTGAAACACGAGTGCAGGAACGACTTGACGCGGACCTTGACAGACTCCTTGCGTGTCTTGGGGAACGGTGTC
GTGTCCAGACAAACGACACCGGGAAGTGAGAACATGTCGCTGTAGCCCATGCCGAACACGATGGCACCGGGACCCCATTCCTTCACGTAGTTCGCGAGTT
GGGTGGAGATTAGCCGCTTGCTTACGATGTGCGCGCCGTAGTAGTTTTTGGCGTCGATCCACCGGATCGGCACACCGTTGATGACCACGGGGTCTAGCAG
CAAAATATCCGGGGAGATGACGCGGCGGCCGTGGGTCGCAACCTGCTCCTTGCATAAGTCAGCTTGGGTCCTGCATTAGGCACACGGCAAGCAAAAGGTC
AGTGTTTTGAGCACTATAAACCCACACTGTAGATAGACAACGTACTTCAGTCGGATCCCCTTGGCCTTGAGGAAGTGTTCGATAGCCCACTCCAACGAGT
CGGCATTATACTTGGGTGCACCAATGAAAGGATCACTCTTGTGAATGCTGTCATACTCGATAGCCTTGCGCAGTTCATACTGATCACGCTTCGAAAGCTT
CTCCGCCGGTCTTGCCAGAGAATTCTACAAACACACATACCGAGTTCAGACGATGAGAGATCTAGTGTAGCACGAATTTGCGTTCGATAACTAAAACCAT
AGGTACCTTGATCTCGACTTGGCTCTTGCCCTTGGCACGAAAGATGACACGCATGAGCGACACTGGAGGATAGTTGTGCACCGTCGACAACTCGATTAGG
CTGCGGCCGCTGTCGTATTCCTGGCAGATAGTGTCTCTGTCGCGGCGGACGCGGTGCGTGTTGACCAACAGCGACATACGCAGCAGTTGCTTGCGCAGAT
TGATGGTCATGTTGGTCGTGATAGGCAGCATCTGCAGGAGCTCATCGATGTGGTTCACCTGCTTCCGCTTCAGCCGGCGAAAcgtttcttgctgcaagAT
CAGCCCTGCTGCCTGGGTCTCCAGTACCTGCGGGATTGGGGTCACAGGCCATTCTAACTCCATTGGTGTCAGGTCACCAAACTTTTGCTGTGCATCCTTA
ATGTCCTTCTTCGTCAAAGACATATAGCTCGGTCCGTTGTGGTACACCGACGACTgcatcgacga