Description :
From Genome Similarity Track
Location :
Scaffold_380:1278- 2996
Transcript NameFunction/comments
Aphas_H257_18926Hypothetical protein

Sequence
1718 bases(100 bases per row)
GCAGCGGGGATCGGTGGAGACCCAACCAAAGTTCCTCAGGCTTGACGCGGTGTGCAAGCGTCAGCGACTCGGGGGTCATGTCCTGAATTAGCTCCTGGCG
CTGCACCTGTTGTGATGCAGGACTCACTTCCGACTGGTCTGCCTCCTGGAGAGCAGAAATGACCTGTTTAAGGGTCATGTTGTCGGGATGCCATTCCAAT
CGCTTGTTTTTGACGTGTATTCGCTTAACCCAGAGAGTCGGATACGGTGGAGCAATCCACACCACGGTCTGCCACGCGGCAGGTTGTGATGGGCTTTGTA
TAGCCCCATTTATCGACTTGCCACTTCGCAATGTCAGGGATGGAGTGAAGGTCGTCGAAGAAAATGGGAGTAACCCAATCCGCCAGAGTGAACGTCGCCT
CACCCTCTTTACGCTTCGTTGTTCGATTGGGTGTAGTGTATTCCTCCACCTCCATGAAGGCTGAAGACGGGGTCCTCAAGGGGATTGGGATGCTGCCCAT
CCGTTGTAGGGGTTGGTTCGGCAGGGGGGATTGGATTCCATCCCCAAGTCCACATCTGTGGCTCCTAGTCAGCAGCCTGGTGGGATCGGCTTGCGTTTCC
CTCGTTTGTCTTCAGTTTACGTTTCAATGAACTGGCCTGGTCATGCTCATCACGCTCAGTGGCGAACATACTATCAAGGTCGAGACAGTGGTGCGAACGC
CCTCCTGTTTTGGGTACACGGGACGGCGTGTAGTGTTTGGAATATACCGCATATGTCCCTCCCTGGAACCGTAATTGGTCCACAGGGTGGTTGTTGATGA
TGAGGTTCGTCGGCATGTCATCGGTGCAAAAGTAGATGCGCCAAGCATTCGTGTGGCACGACGTGCCTGCGTTCGTCGATCTGAATCCCTGAAACAGAGG
CAACGTCTTAAGGCGACGAAGTACTTTCATCAAATCGACAGAGTCGAAATTGTACCGGATGTTGGTGATGTCCACGTAGAACCGGATATCGAGGCCCCTG
CTCGCCCCACCTGCTCCAGTAAGTAAGGGGGTAATCACTGAGAACGACGTGACTAGGATACGCATAGTCTGCCCAATCATGGCCTACTTGGTGGCTTCTT
ACGCCACCGTAACCACCATATCACCCCACAGGGCTGATTTAGCACGACGAAGTTGTCCAGGTGTGTGGCTCTATCAACTTCTTGATTGTCCTCGAAAATA
GCTGCGATTATCTGGTCATACTTGAAAGAGGCCAGAGATGTACCAGTTTCGACCCAGAAGGTGGCCGTACCCACCTTTTGCTTGTATGGTGTGGCCTCGT
CAATGGCCCACAGAAGAGAGTCATAGTCACAGGTTTCATCCTGAGCGAGAGCCAGGAGTTTCTCCACCATGGCGTTTGACGGCCGAGTAAGGACTTTCTT
GACCTTGAATGATGCCGTACGCCCTGTAGCCCCCGCAAGCGTGGAAGCATTAGTTGGACGAGCACCACTAGCCTCAAGCAGCGTCGGCGGCGATACAAAC
GGCTCGTGAGCAGCGTTGACAGCCGGATCCCCATCATACGGCAGGCAGGACGATTGGGGGGCAGAGGGGCAGACGAGAGTCGTGACTGCCAGGGACTGTG
GCAGCGGCCATGCGTGGGTCGTTTGTGGTGTTCGAAAAATGGGCAGAAAAGGTACTCGAACTTGTGCGGGGTAGACAGCAAAATTTGTAGTGCGCCGTTG
GTTTAGTCGTAAAATACA