Description :
From Genome Similarity Track
Location :
scaffold_253:12775- 43757
Transcript NameFunction/comments
g6355.t1hypothetical protein
g6356.t1hypothetical protein
g6357.t1 hypothetical protein PHYSODRAFT_537941
g6358.t1 conserved hypothetical protein
g6359.t1 tyrosine aminotransferase, putative
g6360.t1 Rab1 family GTPase (PiYpt1) putative

Sequence
30982 bases(100 bases per row)
TTGGTGTCCCCAGTTGACTGTTGTTGTAATGGTGGAGACGTCGGTACTTCAGCTGTTGTTACCACTTCTTCTGCTGATCGAACTGCGTTGTCCGCATCAG
TTTCATCGCCTAATGACTCGATAGGCGGTGGAGGTGGTATGGCAGCTGTATCTACCACGTCACCTTCCACACTTTCAGATAGGGCTAAGGCCTGTTCATG
CAGTAGCTGACGGTGTCGAGCACGACGAGCCATCGCCTCTGTTTCTTCACGCACAAGCGACTCCATCGCGTGCATATTCGCGAGAATGAAGTCTGCAGAT
TGCTCTGCATCGTCTTCACAATGGCGGAGAGCGTAAATGCACCAGTCCATCGGGAATCCCATTTGGCTGAGAGCGATACCCAGTTCCATCCGAAAGTTCG
GGATGGAGTCGTCACTTACTCCTTCCTCCCCACCTGCGAAACCTCCAAGATCTTCTTCTTCTTCGCTGTAGTACGAATCCTCTCCACTGGCCAGTCCACT
TCCAGTTCGAGATAGCCCTGGCTCGAGTCCTCCATCTTCGACTCGGTGTCCTCCAATGAGGTCAATCGAGTCGCGTTGGTTATACAACGCAAAAGCAGGG
TAAAACGTTCCTTCGAGCTTGGGACCCGTGCCACCAGGACCAAAGGCAACACCAAGATCCTTCCCATTGAGAGCATAACTCAATGTACCTCGACGTAGGT
CCAGCGTGAGGCGTACAACGTCTCCAGTCTTGAACTTGTCGCCATAAGTGCCTCGTTGTTTGCTGCCATTGTGCCACAGTGCCCGATTGCCAATCCAGCC
CCAGCCGCGGTTGTCCTTGCCTAAGTACGAGTCCATCCGAACGTCTCTGCGACCGATTCCCAAGAAGATGTTAGAACTTGCAGTCACAAAAGTGATGCGC
ACCTCCCAAATATGCACCCCTCCATCGAAACGGGCCACCCCAATAGCTGTTTGCCAGCCCTTATCGCGCACGAGTGAAAGTCGGGTATCCCGGGCTTCAA
GCTTTAGGTAGGGGCCCTTTCGCACACGATCTACACGGCACTGGAAGTTCGATTGAACTGGGAAGCGCCACACAAAGCTATCCCCATCAATAGTGACTTC
CTGCCCTCCGCAGGCACCAGTAAACGCTCGCACTTCGGCTTCACTGCCTCCAGTGGTCGCAGTATCAGCCCCAGCTTCACAACCTGCACCTCCTCCTTGG
AGGATCTGTAGACAATGAGAACTAGCCGTCTCACTTTGAGGCGCCAGACGCACCCGAATGCTTGTGGCTAGCGGAATACTCACAAGTGACTCTTGAAGCT
CGAGATCATACGGATGCGCAGTTTCCACGCGGATGCACACATCCTCCGAAATCTCCGACAAGAAATTATCAGCGGAAAGCATGAATTCGTCTGGCAGTTG
AGCCACAATAACAGCATCAATTGATTCCTCACTTGATTCGTCAGAAGCGGTCAGCTCTTCAGTCCTAGCCGGGTCCATCAACGCCTTCATCACGCCGTAA
ACTTGACTTAGCGGCTCGAACCACTCGAAAGCACTCATCAGGTTGTCGCAGTCAAGCGAATGAAATCTGAAGCTGAAGTTAGCGTTCTTTACATACGTTG
TCGCCGTAGCCCCCAAATTGGCGAGTAGTTTGCAGTCTGCATTGAAAGACATGGTCGGGTGAAGCTGCTGAGGACGCGAAATACTCGAGAAAGCGGTGCC
TAACAGCTGTCCGTTCTTGGTGAAGAAAATCTCTTGAGTGTCGAGACGTAACCCACAACCAAAGACATCACCAGCACTTACAGCACCAGTAGGTTCAATC
CATCGCCACCGATCTACAGCAGTGTCACCCGCACATAGTACTTGACCGTTTGCTGGTGTAAACGAGTAAGACCGAGAGCTGTCGGCACTGCCACCCACTA
ACACTCCTTCCAGCGGGAACGATGGCGGCGAAAACCCGAGCGCAAGTGACCCACCCATGCTGCTGCCAGTGCTCCACTCCACTACAGTGATCTCGAAATA
CACAATTTCAGCCTTTACCTCGTCTCGCATTGTCATCACGAGGGCTGGTGTGTGCTCAAAGCGGCAAGAATATACCTCCCCAGGTGGTACTCCAAGCCCC
TCAGCTGCCATGGCATCTCGTGATGAAGAGTTGCTACCATCTTCCGCCCGATAGTCCAGCAAGAACTTGCGCTCTTCTCCTGATAGATGACGAGAGACCG
CCATCTTGGACGAATGGCTCACCAGCATCTCCACAAGAGGCTGTTTGGAAAAGTGGAAGCGATACGGTAGGCTCAGTGTGCTGCTGCCGTCGCGTTCTAA
ACAGGCTGCTAGCTCTTGTACTCGTTGACTGCGTTGTTGATCCTCGACCGCCAGCATCAACTCCACGAAAGCCTGCAATAAAGCGTGAAGCGTGTATCCG
CCGTCTTGGTCTTGGCTGAGCGCCATAATCTTGGAACGGCAGTAGATGAGCGACTGCTTGTCATACCAGTGAGCACCGCGCTGAACAACCGTAATAAGAG
CTCGCAGAAGAGCTACTGCGTGTTGCCCGCTTGACGGTTGATTCTCCCGCAGTACTTGTTGCACCAGTGCGAATAAAGCAGACTGAAGCTCAGGACGCAA
CTGAACGGCAGTAATCGACTTTCCATGCTCTTTTCCAGACACCAGTCCCTGGTAGTGAAGTAAAACCTCGAGGAAGGCAAGTACGTTGTCCACTGTAATC
GGTGCGCATAGTACGGTGTCCTCGTCAGATAGGTCTAAAGCAAACGCAGTGCTGGGATCGTTAGCACTCGTATCGTTCAATGTGACCACAGGTAGAAGCA
GACCACTGTTAAAGTCCGAATCCACAGCCCAAAGAGACGTCTGGACAACTACATCGTCGGCCACGGGGAGAAGCAGCTGAATTTTGGATGAGTCATTCGA
CTGGTTTTTGGCATTGCGACTTGGTAAGACCTGATCGTTCTCTCCCATAACCTCGTCGTCTTGAGCTTCGTTCTCGATTTCGACTGTGGTGGGGAGTTCC
ACACCTCCACCTCCAGTGGATGCAGGGGAAGCTGCACGCCACACGCAGTTGAACGTCTCTACACGTTTCACAAGATCCTCACGTACGCAGCGCGTACAAG
AGACATCAGGAGGTTCAAAAGGGTCTTCCTTGCTTCCAGCTACGCATCCTAGTGCCACGTATCCAGACGGAGCTACTGGCCACCAAATCGAGCGAAGTTG
TTTACGCTGGAAATCCGGATCGCTTTCCGAATTTCTGGGCAACCCCTTTCCAGTAATATCCACTCGTTCGAAGCTTGCTGGAGGCGCTAAACACCCTTGG
TTATCGCTGTCGCTGACAAGAATTATTGGACTATCTGGAGCGCCGTTACCGCACTTGACAACGTCCCCGAGGAAGAACCATTTACTGGCTGGCGTGGCCG
ATTCCAGAGCTGGTGGCACAACTGGACGCCAGATAGTCACAGCGTAATCTGCAGTCGATTTCATGCCGTTTTCATTGATCGACGGACTAGAAAACCGTTT
CCGCCACTTGTGACGGTGTTTGAGCAGAGGGTCGGGAGGAGGGATACTCCACAAGCGCTCGTATGTGTCAACTACAACAACTTCCATACCGCAAGATAGT
TGTATCGGTCCTTTCGGGTATCGCCCATCCACTTTGCGTGTACGAAGTGGTGAACTCTCCCAGCTCATAGTCGCGGTAGGAGCAGAGTGAGTTCTTGAAA
TAATGTGCAGAATTGTCTCGAATGTCAAGTTCTCCAGTATACTTGGTTGATCCGGAATATTGACGTCTTCACCAGCGGTGGTCCCTCTGTTCTGCTCACT
TTCAACGAGTGACTCGATTAATCGAGTGACGCCAGCCCAGCCCAGCTTTGAGGGTTGTTCGATCACCTCGTCAATTGATTGCTGGAGAGTTAACAGGTTT
TGAGACGAGCTCATATTTTCCGCCAACGTCTGCGTAGGGGAATTCGCCATCACCTCATGAGTCCTACGAGAGAGAATCTGCTGAATTTTCCCAGCCTTTT
GCGCCTTCGGCTGCTGCTGTAGTTGATACTCCAGGTCATAGGGAGATTTTGTGGTGGCTGGCTGAGGTGCATTCAGCAAAGATATCAATGGGCGAAGAAC
CAGGGGGTTAGCTAGCTCGTTGAGAGGCGCTTCCTCGTTTTGTGACGCGTTATCCACCAGCCTCACAATGTGGAGTAGAATCTTTCGAGCATGAACGGCG
GCAAGGCGCTGACACAGTACTTCCTCTTCGAGGTCAATCTCAAAGTCATTCAGCTGGCGGATTCCGTCGTCGAAACTGCTGTTACATTCGCTCCAAAGTG
TCAGATCTGACTTTGGCTCCAGACTCACGTTGATGGGGCGCTCTATTTTCTTCGTCTTCACGGGACTGCCATTCCCTCGAGATGCAAGCCGCTGCTGCAC
AGGATGGCACACCGCACTGGACTCTGCCAAGGCGTAACTTGGATTCTCGTCCCCAATGTCTTGGAAGTTTACCAAGGGCTCACTACTCTGTTCGTTCGAC
CCCAAAATATACGACGCATCTCTTGATTGGCCAGCACCTTGATGCCTGGGTGATAATACAGACTTCATCAGCTCAGCACCAGCGTCCGACAGAAGAAACC
GCAGCGCATTTCCAAAGTTGTTGTCCGTCTGTCGCAGAGCCTCAGCACACACTCGCTCAGGTTTGCCCAGGACCATCGCTAAATGACGGACATTGGACGG
ATAGTTGTGCTGTAAAAATATTAAAACGTTGTACTAGTTAGCATCAATCAGGCATAAGAAATGGAGTAAGGACTTACCACGTCCAACCCCTGACGATGTT
GAATCGCCATGAAGGCCTCATCCAAATTACCGGCTGCCATCTGGAGGGCTTCTTCACATTCTGACGTACTCACAACTAAATTTGCCTCTTGAACTCGAGC
AAGCAGGCGTAAGCTTAGTACTTGCATCTCCTGAGCATTCTGCATTCATTACAAATATCAAAAGAAGCAGCAAAAGTGTAGTTAGGTTTACGACAGACAA
AAAGGTCGAAGACAGTTACGTACCGAACGTACGGCCAATCCAGTCTCGCCACCGGGACGTAAAACTCGGGTTTTCGAGAGTTCGCTGGGGATACTTGATC
GTTGTAAAGAGAAATCACGATTCACACTGTCTCGACCTAGTGCGATACGAAGCATTGACCCAACTCCACCTTCTTGACGAGGTGACGTGACCCCTGTAGG
TTCGTTCGGTCCAAAGCTCTCTCGTTGTTGGTAGGAGGCAGGAGACAGGATAGCTGTTGGTATCATCGTAGAAAACATACTTGGAGTGGGAGGTGCGGCT
GCAGGAGTCCCTGGGGCTTGAAGAACGGAGGACCGGGGTGAACTGTATCCACCAGCTCGAGGGGAATCGACAGCGGGGTTCGGCGATAACAAAGCTCGAG
GAACGTTACTTTCTGCCACAGAGGTAATCACCCGCAATCCCTGCGTCACCGCCTGGCGGCTTATTCCCGAGACGGTAGAGCTTCCTTGTACTCCACGATT
CTGTAGCTCTGCTGGGCTTCTGGGTACGATTTGAGGTGTTCCGATCTGTGGTTGCTGGTACTCCTGGCCAGGGATTACGATATTCAGGTCTCCGGAGTTC
TGCGGCGTCGTGACAATCGGGGGTGGCGCACTTCGCCCTCCAATACTGCCAGTGGATGTTCGGACTTGGAATTCGTAGGTCACTAGACCACCTCGAGACA
GTATCAGGGAGATTCGAGATCCTGAAGTGACTCGTGTGCTGGACCCATGGATTCTCACGCCGTTAACGATCGTACCGTTCTTGCTGAAGTCCTGAAGCTC
GTACTGTTCTTCGCCACCCTCACCTTCACGTCGTAACCGACGCAAATGGAAATGACGACCACTGACACTGCGATCATTAACGATCAGATCGCATGCATCT
GCAGCGCGTCCAACACGAATCATAGGGACCGTAAGTGGGAAGGGAGCGTAGTCGATAGCTGCTTGCCCTGATGCGCCAGCTTGGCCGTGTTCATTCTCGT
TCAACGGAGGAAGAGGTAGTAAGACCCCCCAAGCACCAAACGGCAGATCTCCCTCATTCGAGCGGTTTTCATGTCGTTGTCCAGCTCCACGACCAAAACT
AGACGCAGCTCCAGCAAATGACGGATGGTTCACCTTTCGACGAGGCGATTGAATGGCGTCCATTCCCCAACTCAAAGCGTTTTCGCTTCCCAATTTTTGA
ACTACCTCGTTCCGCATGTTAACTTCGTAATGGTCCAGTGCTGAGTCGATCACTTCCTCTGTATCCAAGAACATTTGGCGCTGTTTCACACAAATCCATC
GTTTTTGCAGAGAATGGGCAGCTTCAACGCCAGATCCTTCAGACTTGCTCGCCCACGACAAGGAATTCTCGGATGCCAACAGTGTGGCCAGACTCGATAT
CAGTTCGGATTCAGCATGTAAGAACGTCGGACTTAGTTCTGAGACCTGCTTGAGTAGAGATGACAGTGCTTTGGAGGATCGCCAGCGTATCTGTTGCTTG
AACGTCTTCAACCGATTCCGCAGAATCTCCTGGACGGAGTTGTTTTGGGGAAGTTCAAGGTCACAATGCATTGTGCACTCGTCATCGATTAAAAAGTCCG
CAGAAATCAACGACGATAGTGTTGATATGATGTTTTCCACATCATCAAACATGTCCACAAGTGCTGGAATGCGCTCCACAACATGGAGCTTTGAAAGCGC
GAATGATTGGGCTCGTGAACCCGCTACAACAAATGGCGAAACGGGTCCATCCGATCTTACCTCGACCACTACTTGAGCCAATAAGTCAGCTGTGCGTGGA
TCTCGCGTAACTCCTGACAGGACACCAAACGAATTGGACCCTTCACCTTCAATAGCCACGTACCCACCTTCCCTGAAGCCTACAACATTTCCACCGACAA
TACTTACAGCCGCTGTAATCGTTGCCAATGCATCCACAGCGTCTTTGGCCTTCTGCCACAAGATTAACGACTGTTTGTCGCGGGTGGTTTCCAAATCGTC
GGTGTTGCCATCGGATGTGTTGCTGCTTGGCTCGTCCGTCTCAGGAGACGAAGTTGCTGCCTCAGGTTTTCTGAGTGATGTTGTGTCGGTATTGTCACCA
AGCTCGCCAAGTACTCCAGTTGTTAGTACACTTTCAGCCTCCTGAACGCTAGTGTAATACGCGCAAACCGTATCCAGAAGCGACCCAACTTGATATGACT
TGGCAAACCCTCGGGTGAGTGCGGCGTTAATCGCTACTTTCCATGTAGGATAAAGCGTTAGATAACGCAGCAAAGCCACCACCTCAGCCGACTTTGCTTC
CGCAACATGGGCCTTCTCAAGCACTTCTTGTTGGACCTGTGCGACCCCGAAATCTTTGGCCACGACAACCCCCTTTAGACAGCGTGCGGACTTACATAAT
GCAGTACATGAACACTCCAGGCCTAACTCGTGCGCACACAGGCGAGGGCGTAAGAGTAATGGGAGACCAACTAATGCCATCAGCAGGCTGAGTATGTCTC
CAGAGAGCGCAGGAGCAGATTGTTGAGACCGATAGATCTTGTTGAGTGCAGACACCGAATGCTGCGGGAAGACCAACATGGCTAGGCGAATGCACACAGT
TGCCGATGCCAAGTCGGACGAATTCATCCCCGTGATAATGTGTGTTGTAACCACTGCGTTCGTAGCGATGATAGCACCAACATTCGTGTTCGCTGACCCA
CAGGAGAGGAGAACACTTAAAATCTGATTCCGGTAGTAGTGGCCATGAAGGGAGTTTGACCCTACTGTCCCAGGTGCCGGGGAGGGTAGAGCGAGCTTTG
AGCCGAAAAACTGCAGCAGACTAACACACACGCGCTTCAACGACGCGTTCGCTACCAGCTCGTGGGACGCTTCTGCAGTCATCACGTTGTTGCCAGTTGC
AGAATCATCTTGTAATAATTTCAAGTTTTCCAGCAAAAAGCTGATAAACGTGGACAGCACTGGATTCACACGCGCACTTGTTGAACGACTTCTGCTACTG
TCTTTGGCATCTTGGAGAGATCGATACATCAGAGCGCGAGCCATTGCCCACCCAGCCGCATGAAGCTTCACTAATGGTAATTTGCGCTGTGGGTAGCCAC
GCTTGATCTGGAGTGGCAAACGCTTAGTCACCGAAGTCTCCCCAATATACTTGGAGTCAATCTCCTTCATCAACGACTCGAATAGGGCATCTGAGTTCTC
AAGACAGCTATTTTCTGGAAGGTCCTTTGCTTGACTGGCATCGTCGGAAGCGCTGTCAAGTCCACGGCTATCGTCTGAGCGGCCAGTGAGAATATACGAG
CTGTAGAATCCGGCCGCTATACGAACAACTTCATCATTTGCCAGTGAGTTCGAAGGCACCGGCAACGGTAGATCTGCAGATGGAAGCGTTCTGGACCCAG
CCCCAAGCTGACCCTTGTTGTTACGCCCAAAAACCATCACCCGCCCATTTGACATCAGGATAAGTGTGTGGTAACAGCCACAGGACGCAGCCGTGATCTT
TGATGATAATGGCAACGGGACGAACTGGGCACTGTTCTTGTGCTCTTTGCTTCCAATTCCCAGCTGTCCATAGTCATTGCGCCCCCATGTGATAAGTTTT
CCTTTCTCGCTGATAGTCACGGTGTGATAATATCCACAACTAACAGTGACAATTTTTTCATCGCTCTCTCCTAGTGCGGTTTTTGCCAGCGCTGGTACTT
TCATGTTGCGGGCATGACCAAGTCCCAGCTGCCCGTAGTCATTCTTACCAAAAGCGTACACTTCTCCTCCGCTGGTAACTGCGACAGTATGGTACAGCCC
ACACGCCACCTTAGTGACAACTTGGCTTGACAAAGTGTCCACCAATTGCGGCGTGTGCTGATGTTGCGTGTGGTCAAGACCCAATTGGCCACAATCGTTC
ATACCAAACATGAGCAGCTCGCCGTTATTCGACACCACCGCACTGTGGTGATAGCTGACTGCTGCTGTCGTAATATGATACTTTTCCCGCAAGCTATCAA
TCATTCGTGGCGTATGACTCTTCGAAATCGTAGACCCAAGGCCTAGCTGGCCTCGATCGTTATAGCCCCAGGAGTACACTGCCCCGTCAGAAGCAACCGC
TAACATGTGCTCGCATCCATTAGCTGCCGCAACCATATTAATGGGGATTCCACTGAGTGCACGAACGGGAGTGGCGATAATCACCCTCTCTTCAAACGTC
CCATTGCCACATTGGCCGCTCTTATTGAGACCGCATGTAAACACAGCACCATCCTTCATTACTACCGAGAGAACTTCATTTCCACCGGCAATATCACGAA
CGCCCTTCGCTGAAAAGAACGGCACGTGCTCCAATTTGCTAGTAGAGTTGCAGTGCCCCAAGCACAGTTCTCCGTAGTTGTTTTGCCCACAAGAAAACAA
CTCACAATCATCGAAACTGGCCACACTCGATAGTCTTTCGGAACTGCTTGTTTGTCCTGTTGCAGCAGCTCCTGCATGTCCGTCGCCAGCTACATTAGAA
TCTTTACCCTTGTTCAACACGCCACCTAGAGCTCGTATCTTATCATTCCAGGATCTTCGAGGAGGGCAAAGCAGTGTGTTCAACTCCATTTGATCCTCTT
CAGTAGCGCTGGAAGTGTAGACAAAATAGGCAGCATCTAGGTCACCTCGGTTGTCATCGTAGCAGGCTGCACACAGCTTTATGCTGTCATCATCGCGTTG
TCCATAGTGTACGCCAGATGACGGCATCCTCTTACACTCTTCACAGCTGTAAGATCCCGATGCAGTCTCGTTGTACGCAGGTCCATTGTCACGATCAAAA
ATGCCGCAGAATCCAATGTATCCAATGTCGATGTTCGTACCCGCTGACGAGCAAATTGCTTTCACCAAAATATAACGACCCGTAACTGGATATGCTAGCT
GTTTGGAAACCTGGGCGCAGCTCCCGTCCATTACGAAGAATGCAACAGGCACACTTTCATCGCGAGGGCAGTATCCATTACTTGGAGGGAACGGCAAGGC
AGCAAATTCTTCTGCGGTCATGTTGTCGAATTCCTGATAATACGAGAGATCTGGAGGTGTGCTGGTAACAAACACGACAGCGGCTCGAAGAGGGCTCGAG
TATCCCGGTCCTGGTCCTCGGATATTGATGTAGCTTACGCACATAGGAGTGTCCACCTCATGTTTGAATACCAGGTTCACATTGGCTCCCTTGGTAGAGC
TATACACTGTCGTGTCGTCCACAAGGCAATTTGAGGCGGCATGAGAACTACTGAATTCTCCACCGTCACACGAAAGCACTTGCAGTAGAAGGCTTTTGCC
CAGTTGTAGCTCGTTCGACGTAGCCATGAGCTGGTTCTGAAGCTTCGTTGCGGGGTGGAAAATGTGCAAAGGTAATTCGGCACGGGGGCAAGGGTGGAAA
TTCACATCAAAGACTGTGCCGTTGCACAGTGCTGATACTGCGGGGAACAGAGGCTTTGTTAGCATTGCCACATTGAATTGGACAATTTCAGGTTCCGATC
GATTTGAGCACAACGTTACGGTGGCCTTATCGAAATCAAACAAAACCCCGAAAACACCCTCTTCTAACACTTCTTCGGCGCTCTTCCACTTCACATCCAG
TTTGTGTTGAAGTGGCGAATCCAGCTCCAAATATGTGCTGTCGACAATACCAAAGCTGAGTGCAGACCGTCCGTCTTTTCCTGCTGCCACAACATGCACC
TCCACAAAAATACTCCCGTTTTCGAAGCCCTGGCTTGCAACAACAGTCTCAAACTGATCTTCTGATGAACTGGAATCACCAGCAGATACAGTAGTTCCAT
TCGACAGGAGCTGTAAGCGACTACCCTTTATCTTCCCGTTACAGCTAATCGTTGCTCCATGAAAAGGTACTGCAACGAGTCCTCCAGAAACGAACGTGTT
TGGGAATTGGAAACTGGAACTAGCGCACCACAACTTTGATGGAATGGAAGCTGCTAGATTCCAATGCACGTCTGCATCCTTTACACCAATCGAAGGGAAG
TACCCGCCTCCTCCCAAAGTGTTTGGACTAAAGGCCGCGACATGGCATCTCTTTGCGCCGTTATAAAACTCCACTTGGCGTTCTTCACAATTGAGTAAAA
CACCAAGGACATCTGAACATTTCCATCGTATCCCTGCTGATCTCAACATATCCCCACTGCACCGTTCGCCGTGTAAAAATACTCCACAGAGACTGGCGTC
CCCCGGAAGGTAGGTATTTAGATCTACTGTGCCAGGTGTGACGCCAACAAACACAGGGGTATCACCCAGTGTACGAACTGATACTTCCCAATACCAACGA
CCTCTGTAGAAGGGTTTATCAAACACTGCAAGCCCGCCACATCCCTGATCATTGCCACTACTTCCGTCCAGGCTTTTGTGAGCAATCGTTAGTTTTCGAA
GGTCGGTACCAAGTGTGATATACCGAGAACAGATTATGTTGGGGTACTTTGATCCCGTGGCTGCAGGTAGTATAGCGTATTTTTCGGCGCTATTCACATC
AGCCTGCGAGTCGTCTGATGCATCGAAATGAATGAAGCTCTGCCATCCTTTCCAGCTCGCCAGATCTGTCAACAACCGTACCAAATTTGTGCGGTGAAGG
TGGTCCCAATCCTCCCCTTTGTAAGGGAAGCAGCAAGTTTCCAACACCAGAAGCATGTCCTGTACAGCAAGCTGAATGGAGGCCGACGATGCCTTCGTGT
CACTTGGTGCAGCACCCACCCCAACTTCGATGAGTTGTTGTACTTGACGAAGATGACCCGTGGAGGATTCAAGCAGAATTGCCAGTAACTGGAAGAACTC
TTGCCCAATGGCAGCCGAAAGCGGAGGCCCAGCAAACTCCAAATCAGCGAGATAGTGTACTTTAATGATCGAAGCCTGTCCAGCAGTCTTTTTACCCCCT
TGTTGTTGCCCATTGATCACTCGAACACGCTTGAAAGCTGAAGACAGTATGGGGATAACGTGGAATCTGGAGCTGGGGATGTTTTTAGTGCACTGAAGCA
GGCGAATAAAGGTCTGAAGCCCTTTTAGACGCATTTTTGCGCGCTTCTGATGATCAAGTAAGATATCGCGCATTTGGTCTTCGGGGTGTCGAGATGTTTC
ACTCTCTCGGCTCGAAGTAGTCACCAGATTGCTGCTTGACTGCTGAATAAACGAGAAAATGTCCGCGTGTATCTGTTCGTCTTCTTCTTCCATCACCTCT
ACCGATTTTGTTTCCATCATCCTGTTTAATTGTCGAGTAAAGCGCTTTTGTTCGGGCTCTTGGGTCGTAACTTCGGCCGGTTCACTCTGGGAAACCTTTG
GAAAATCTGTTGTAGTTGCACCAATGGTAAATTAATTAGTTAGAATTAGTTAAGAACAGTAGGATTAAGTCGTACCGTAGGTTGTTGCTATCGAAATGCC
AGGAAGGAGTTTCATCGGGGACGATGCTGACGGAGCACACTGGATGGGTGCAGGTGACAACTGGAGAAGTACAAGTGCTCTACGAATAATGGGCTCACAC
ACTGCGTTGTATAGTGCCTGCTGGCGTTCCTTTGCCTCCATATCGGGAGAAAATCCGCTTGGAGCCCCCTTTTCACTATTATCCGATATATAACCTTGTC
AGACCCCGAGAAACCCAAAGCTAGCATGGATATTTACCTGCATGCTGCAGCCAGTTTTTGCTGTTCTCTCACAATCCTAAATTCAGCAAGATACTTCGTC
AGACATGTGTCGCAATCAACTGTACCATTCATGATATACTTTACCATCGACGTAGCTGTAACGCAGCCTTCCAGGCATCAACCACAGTTTCAGCTAGGGC
CCCTTCACTTGAAATAGGTTCGGTTGTGTAGGAAATGTTGGTGTGCTTTAAAAGAGCAGCAAAAGTAGCTCGAACCGCGCGGTCGACCGCCTCTATTCCA
CCACTTTTTTCCAAAGTCGCCTCCACACTGTCTTGCCTCTTCAGTCTCGCAACTCGGAACTGTGGCTTTGCACCTCCTGGGGCCGATCCAGGATCCAGAG
CATTGCGTACTTTGTCCAATAACTTTTTCCCATGACCGACGTTTTCCATCACTTGTAGTAGGAGCATTTCATTTCTACCAACTTCAGGTTTAGCTGACGT
AGGATCAGGCCATGTTTCATCTAAGCCGCCACGGAATAGTGGAGAATGCAGCCATCGGTCGCTGGCAACAGCCTCACTATCCAACTCACCACCGACGATC
AAAGTAGCCGCAAAGTGACTCCCGACCCAAGCCACTAACTTTTGTAGGTCCTTGATCCACTCGTGACTTTCTTCGACAATCTTATCAGAGCACCACACCC
CAGGAACAGGAGCCTTTACAAGTGATTGACCAGTTGGTGCTGGAGGAGGCACCGTGCTAGCTTCAACTCCTCCTGGAACAGGTAGTGGTTCCTCCCTTAG
AGGATATATGTGTTGCGAAATAATAGTCCGGCTAGGCACAAACGAGATCTTCTTTGGGTCATATTCGAGAACCCGCTCGGCAGTACCTCTTTGAACTTTT
ACAGCTAACGTTTCGGTCCCAAAAAGTTTTACCAGGTCCGAAGGAATTAGAATTCGTCGGATCTCTTCGTCTTGTGGCAGATCTTTAATTTTCCAGGAGG
TATATCCCTTGGACTGATTGATCTTGTCCCACAAGTGTTTGAAAATCTGACCGTACGTGACGGAAGAGCTGCTACTCTGCAAGAGGCACGTTGAGAGCTC
TTTAGAAACAGATGCGAGTGCTGAATCCACAAAATCAGTTTCTCCACTATTCTCCGGTAAAGCGGTAGGTACATCAGCACTTCCACGTGAAGGCTGTGAA
AGACCCTGTTTGCTAAGGAGTACGAGCGTGGTATGGAGTTTTTCCGAGAGAGACTCTAACTGGGGCCATAATGGATCCAATAAAGCAGGGAGCGCTTCAC
GAACCGAAGGTAGTGAAAACACACTTAGTAACACAAATGGCAACAGCTTGCCTGAGAAACTGCGCTGGATGACAATGGGGAATATTTGTTTCTGTCCAAT
ATCGCGTTGATCCAGGCAGTTCGACGTAAAAGTCACCAACTTCGAGCAAATCGATTCGATGATCATCCAACTTCGGCTGACGGAACAAGAACACCAGAAT
ATCGCCGCTCGCAGCATGATATTGAGGCATTTAAACTCGTCGTTCGCCTCAATAGCATCCAAACTCCTCACGAGCTTAGTCGTATCTCCAGACGAGTGCT
CGATCGCATTTTTTGTCTGTTCCCAAAGTGCATCCAGTAGAGTATTCATAAATGTAACCACACTTTCAGATACAGCGTTATCCGCTAAACCATCCACCCT
GAAGAGAATATTGGGGTCACAAATCAGTTGAAACAACATTTTTGCGGATGTGAAGCACGGGACGAGCATCGGAATTAACGATTGTTGTGCTTGAGTCAGC
TCAGTGTCAGGAGAAGGTTTGTGTACCATCAGGCGATTCATTACTTGTAACCTGTCCAATAGGGACGGGAAAAGTACCGAGAATCCGTGGTAGATTGCCG
ATGTAGTTTCTTGCTTTACCGCGTGATAGAACCATAGTATCTCCCCCGACATTGCTTGCTTCGGTACGTAGTCTGCAATGGTGAAAAGCATTTCACGAAT
CAAACAGAGAATTCCTCCAGGTAGAGTAGCAGTTGTTGGAAGATCAATTTCTGATGCATCCAAGCAACTCCGGGAAAACTATTAAACAATACAACATACA
GAAGGTAAGTGGTCAGTCAAGCGTAGCCACAACCAAGATTTTTATGTAAGCTCTGAGTAGTCGTACCTCGAAGAAATTTAGCTTAAGCAGCCTTATCGTC
ACAAGCATTGGGTAAAGTACGTGCGTCACCAGTGGTGTGTCAGTAGACTGTTCATCTAGCGTTCCCATAGCGAAGAAGCGAGAGGTTATGTTTTCCAGTA
ATGCGTACAAGGCCGAAAACGTAGATTCCTTGGGGTCTATACAAAGGGACCTGTACAAGCACCGAGACAACTGAACAGCTTCAACATCTTCGGCTGGAAT
GTCGTTTCCAGCTAAACGATCCAGATGAGATAGCAAACAAACAGCCGAGTCGAAGGCCTCTGGCACACAATGCTGGATTGATCTGTTTGTAGCCCCACAC
TTCGCGCGAAGGACACTGAGTACATGCCCTGCCTTCCCAGTAGTTGATAGGTTTTTAGTCATATCAAGACGGTATGATCCTGATGGATTCGTGGAACAGA
TCTTTCGCACTCTGCTGCTGCTTGCTGTTTGTCCCTGAACACTAACACGCCCCCCGAAAATAAACATATCTCCACCCTGCTGGATAGCTGGTTCGAAATC
AGACATGGTGGGCAACGCGGTTACCGCTCCTGTTTGCACGAACAAAGCTGCCGAGCTGCACCCGTCCACTTTTTCAGCGTGCGTGTTAACTTCAATGTGA
CTCCACTTTTGAGATGCCACTGAGAAACACCACAAATCACTCAAAATGGTGTTGGTTCGGTTAATTCCCCCCAAAATCCAAATGTTTCCAAGGTCCGAGC
ACATACTATAATGTGCTCGTGGTTCCAGCAGCATCATTTGAGAGTCGCTTCTTGAGACAGCCGTTGCCTCTTTCGAAGTTCCAATGCTGTCGTCATGGCA
TAAATGCCACAACCGGTCAAATGTGTTGTATCGCCAAAGATCGGATCGAAATTTTTCTTCACGATCTTGTCCGCCAAACACGTACACACACTCTCCAATA
ACAGCAGAGGAGCATCCGAGTCGTGGGCCAGGATCAAGTGATACCGAACTTGGCAATCGAGACCAGGCGAAATCCTCGAGTGACAGATACCACGCGTCTC
CGAGAACCTCATCCTCAACGGACTTCCCGCCGTACATGAATACGATCGTATCGAGACGTACACGGATTGTTGACGCTGTGTGGAAAGCACGTGCATGGGG
CATCGACGTCGCTGCACCGATAGCTGCTTGAATCTGAGTCCATGTCGGGAGTGAGCCATCAGCATTTTTAACCGTAGAACACTTATACAGATCCATGTGC
CTTGACGCAGCACAATTTGTCTCTCCTCCAAGGACAAGAACTTGGTTGTCGTCTATCGCAACAACTTGATGGTGACAAATTTCGATGGGGAAATCCGCCC
ACCTTTCCCAGTTTTTTGTATCAATGTCATACACCCACACTTCGTTCGTAGGTTCTGCTGGCTGGGCCGAAGCTGATTCATGAACAATCATTCCACCGAC
AACAAAAAGTTTATTACCAACCATCGTCGAAGCGGAACCTTCCAGAGGCGGGGGACGTGCCGTGGTATCTTCGGGTAGTTGGTCTTCAGGTGATTGAAGA
ACGGCGCTAGAAGAAGGCATCGTTACTGCACGAGAAATACTTTCAAATTCGAGACCGGTAGTCGGTGGATATGCAAAAGGCTGATACCCCAGGTTAATTC
GGATGATCTCCCCTCGCTCGAGACTGATACCAGGCATCATACCTGATCGCTTATCGCCGACGGAGCAATTTAGTTCCGAGTAAGCTACGCCCAAATTGAC
TCCATTCCGGAAAAATGTCATCTCTTGTGTGGTTAAGTCCAACAAGCAACCAATGATATCACCTGCCCTCCATTTTTCTCCATATGAAGACGATCCACTG
TTCCACCGCCGCTGGCGGTTACCATCATAGGACCACGAATGAGCATGGTCGCCGACTCCTTCACCCTGGTCCGAGCTTCCCTGGAAGTAGCCATCTATCC
AACCTACTTGAATCAAACCACTTGTAACGACTTCAACCTCGTAAAACCATTTGCCTCGGAAAAGTGACACGCCAACCGTGGAAATGGAGCCAAAGTTGCT
CAAACCCTCAATTTCCCCTGAACGGTCAATGTCAACACGACCGCATACGGAAACGACGCAAGATTGGTCCAACATAACGAAGTCACCATCATCGTTTTCG
CGTTTTCTCTCCACAATCAGCGACGTGGTGTAAAACCCAGCAGCGACATCCACACACCGACGAGAATTTTTCTCCGGGCGAACTTTGAGGGGAACCGGCA
GCAATGCATCTGCGCTGCCTCGATTTCCAAGCTGACCTTTGTTGTTCCGCCCAAAGACGAATACTTGCCCTTGTTCAGAAAGCAGCACAGTGTGGTAGCA
CCCACACGTTGCCCGCACCATTCGTGTGTTGGCAGATAAGGCTACTACGCTTGGTACATTCTGATGAATCTTGCTTCCAATTCCAAGCTGTCCATAGTCG
TTACGACCAAATGAAAACGACCGCCCACCAGTAGTAACTATCATCGAGTGATAGTAGCCACATGCTACAAAGCATACAATCTCATTTGGAACGGCGACCA
GAGTGGGTATCTTGATCTGGCGATTGTGGGCTAGGCCCAACTGACCGTAGTCGTTCTTGCCACATGAGTACAGCTCCCCTGCTGCCGTACAAATGATTGT
ATGATACAATCCGCAAGCTACCGTGGATACTTCAGTGCCCTCAAGGCTCTTGACAAGTTGAGGCGTCGACTGGTGCTGGGTGTGATCGAGGCCAAGCTGA
CCACAATCGTTCATGCCAAACGTATAGAGTTCCCCTGCGTCAGTGATTACAGCACTGTGATGGTAACTCACAGAGGCATAGCTAAGCTTCTTGTCCTTCA
GCGACTCAATAAGCTTCGGAACATGTATCTTGGTCGTCAGGTTTTCATGCCCCAATTGTCCTCGATCATTGTAGCCCCATGAATACGCGAACCCAGAGTC
CGTCAGTGCGATCATATGCTCGCATCCGTTGCTCGCAGCAATAAACTTCACTCGCTGAGAGCGAAGAGCGTGCACAGGACGGAGCATCATAACTCGTTCG
TCAAAGTGCCCCTGCCCACACTGACCGCTCTTGTTAAGCCCACACGTTAACACGGCACCATCATTCGTAAGAACTGCCATGGTCTCGTTACCACTGACTA
CTTGGCGAATGTCATCCCACCCGCATAGTGCGACGCTGGTAAGCTGATGCCGTTCAATATCGTCTCCTGTTCCAAGTTCTCCATACGAATTTTGTCCGCA
ACTGTACAGTTCTCCTGAAGCCTCGCACTTCCCGTACATGGGCTGCTCTTTTAGTGCAGCGAGTTTAGCAATTGACGTTTCCAAATCCACCGAGCTCGTA
GGTGCTTGTTTCACCAGCCAAAGCACGACAAAGAGCATCGTTGCAAGGGAACCGCGGGTCAGTCCCACCTCCGCCAAAGTTTCGATCGTGCGAGCTCCGA
TCCGCATTTCGTCTTGTGGGGGCCCATCAGTACCAGAGTAAGCCAGTTCGCCAAGACACTCACTCAATAGATTGAATGCCGAGGAAGCGGACGGCGCGAG
GTACATACTGTCTGAGTAGGCAGTCGGCTTCAAAGATTTCAGGTTGTCTTTCACCACCTGCAGAGCTTGTTCGTATTGCTCTGGGTTATTTTTACGTGTA
GCTTTCAGAAGCATGACCACTAGGTCCCAGCCCATGGTGAGGCAGTTCTGCGTCGGCAGCGGTAACGGCGGGGGCGACACTTTGAGCAGTGACATGGCGT
GAGCCCTTGCGGCCATCAATCGCTGTTCATGTCTGTATTTCTCCTTCTTCGTCATCTGGTACAGAGCTTGCAAGTTCTTCACGTAGCTTGCCACGCGGGC
ATCGAACATGCCTGGCATCGTCTCCGCAGAGTCCCGTTTCCAGTCAGATCGTGTAGGGTCGAGTCCGTCCTGTGTGGGTAGTCCTGCGAGCTGAGAGATG
TGCTGGAACAGCGCGTCAACCGAGTCAACGGAGCTCATGAGTTCCTTCATCTGTTGCTCCGGACTGCGCGTCTGCAAGCGTCCCGGCATTTCGCTCTCTG
TACAAGCAGACAAAAGTGAGATGGTTGTTCTGTTAACATAAATAAAGGGTTAAAGTTTCACCTCTAGGAAGGCAGCGTAGCGCCACGCCGAACTCGAGGA
TCTTATCCATTGTGTCCTTTGCCTCATCGGCGACGGAACCCACCGCCACGCCCGCGTCGCCAGCTTTGAGGACGTCGCAGAGCGGTACGTATGGCGCCTG
CAGAGGACGCAGCTGCGTGCGCTCGCCCGGCGGCTGCGTCACCGCGGACGGAAGCGAGACCTGCTGCCCCATGGCCCAATGTTCGAGGTCTTTGGGTGTT
ATCTCTCGTTGGTCTCTGGGCTCTTCTCAGCCACCCGGGCGGAGATCGTTCATCCGAAAGGGCCGGCGACTCTTCCGACAGAAATGGATCTTGGTGTGGT
GCACGTACGTTATTTGTTTTAGTCCGTTACTTTTGGTCAGACTTTATTTTGGTCTGCTCTCGTATTGTGACACTTGATACAAGCCGTAAACTAGAGCGGA
TTAGTACATGTAATAGTTTGATATTGTATATAATAATTTTGAAGGAAATATTGGTTGTTGCTTGTGTGAGTGAAATTCATGACCATCCTTATAACGAACG
TGTCATTTTAAAATATCCAGAGAATTATTTTTTGCATTACGCATTTTATTTTGATTAAGTGAATGTGTGATTGGAGTCTCAAAGCAACTTTCGATATTTT
TATTATTATTATTTATGAATTACGTATATTTAGTTTTGCAAAAAATATTGGAGTCACAAGCAACATTCGCTTGAAACATGAAATGATTGTACCATGCGCT
TTTCGTGTGTAAATTTGGTTTGGTGCAATCATTTAAAAATTCAGACCTCCCGTCTGATCGTCGATAACATCTCTGGATTAAAATCCAGAGAATTTCTGTA
CATGTATAATAAAATACATGTACAATTTTGCACCATGAAGTCAGAAACAAAATTTGTTTTGCTTTTCTCTTTCGGCTTCTCTTTTACTTTCTTCAACTGA
CGTTCATGCAATACCGCCTTGTAGATGCGCGGCTAAAAGTACCGTTTTAGCCCTGATACGAGCCAGCGTCTACATCTAGGCAAAGCTTCCAGCTTGTCGT
TGTGGGCACTTCTTCAGCCATCGTCAGGGGAACTTCGGTCATCTTTTTCTATTTGAACTTTTTCGCACATCCCGTTTTGTATCGGAACTGAAATCAAGAA
CTTTGCCTTTCGATCCGATTCGGATAAACCTCACTCAGTGCCCAGTGACTCGCTGGGCCTTCGCGGTGAGGTGCAGGCTTCACCTCGTCGCCGTCGTGTT
CGGTAATGGTCAGTCCAATGCGATACGACCTGTACAAGATCGGTTTTCTTTTGGCTGTTCGGCAGCGAGCGTCTTGACCGCTCTCTGGAAACTCGAGACA
TGGTGTAGCGCTCCCAGCTGGCGGCTGGGTTGAAAGTCTCCTGTGGCAGGAAAGTCTCCTGTGGCAGGCAAGTCTCCGCTACCCCGAGCCGCGTTCGTCT
CTCTCCCGCGAGATGGCCAAGTCATTCTTCAATCAAGCGCGAAACCGGCAGTAACGACCGAGGCTGCCCTTGTCGAGACAGGTTGGTGGCTGCACATGTT
TCTCTTTGACAAGTGCGGCGGGCACTGACAGCAGACGCCTCGTCGTGTGCAACGCGCTGTTCTCACTGTGATACCCCTCGCTTCTCTTGCTTGTGCTAGT
TCATTCCCATCTGTCTGAGACTCGACACCTGCTCCGAGGAGTCTCGCCATTCGCACACCTGCCTCAAGCCACGGTCAATTGCCCGCTAAATATCGCCGAA
GCATCTGGTGGATTGAGCTGCCCTCCATCAAGTGACGAGCAAGGGAGAGAAAGCGGGTGTATAAGAAGAAGGAGAAGAGACCATGCCAGTTCAAGTGCAG
AGCGACTTGCCTGGCAGAGAGCACCTGGCGCTCAAGCGCGCGCACCGAGAAGATCCTGTGCTTCCTCGCAGCCGTGCTATGAAGCCTGTTGTCGCCCCCA
ATCGCAAACCGCTCGTGAAAAGCCGATTGGCAATGGTGGCCAAAAGCGAACGTGTCAAGAAACCGCGGCGCCTTCCGAGCGACGAGACCGTCTTCTATTC
GAATATCTGGTCCCCACCCGAGACTGCCAAAGAAGTACCCGTAGCCAAGAAGTGCAGACAACTCGTGGACATTAGCCAAGTTGCTCATGTGCTGACGACA
ATCGACTACAAGAGCGGCTACGAAGGCTCAAGCGACACGGACTTTTTCAATATCTGGGCCTCACTCGAGTCGCAGCAGAATGCCATTGCTGCCAGAAACG
TGCTGATGAGCAAGACGCAACAAAATGCCAGTAACTTATCGACGCCCATTTCCGAGCACAGCAGTGAGGAAAGCTCATCTGTCGTCACTCCATCTAGTAT
CCTGAGCCTAGGTCCGTTGAGAATGGACGCTAGCACACTTCGAAGAGAACTGTCGTCGGATGATTTTGCCAGTGTGAAGAGCGCACCAGTATCGGGACCG
ATGAGGAAGGGGGAAAGGGTGGTGTTTTCAAACGTGCTGACCTGTAACGATGAAGTGGACATGAGCTGGAACTCACAGTTTTTGCTTGGACTACATGAGC
CGGTTCGACATGCTCTTTTTGTAATCGATCGGTTCTTGGAGCGGAGTCGTGACTTGAAGTCGCCCATGAATTGGAATGTGCGCGAGTTTTTCACATGGTT
CAAGCTACACTTCGTTGAGTTTGTTCGGAACCAGCACGACGTGAAGACTACGGTTCTCCTTCCGCTTGTGGCAATCAGGTTTGTGGAAAAGCGTGACATC
CTTGCTCTGTATCAAGCGATTTTCGCGCTGGTTGACGTGGTCGTTGCCCAAGAAGACGATCTGGTCTTCTCAGCAGCGTCGTCTGCGGATTCTTGGCAAA
CCCGTCTAGGCATGTTGCAAGACGACATCCGCCGGCTTAACCACCTGCTCTTCAACGTGCTGGCACTGGAAGAAGAGGCCTTTAAGCCTGCTATTGAGCT
TGCCTTTTCGGAGAAAGCTTTTCAAAAATATGTCATGCCTCGGATCTTTCGTGCAACGAGACCGAAGCGCGTGATGGTGCCATGGATCGTGGAGCGGAGT
CGTGTCTGGGGTGGAACAAAGGTTGCTAAAGCGTATAAGGATGACCTTTCATTCACGGCACGATTCCTGTACGACCACGTTTGGCACCCTTACTTTGAGG
CCAACATAGCATCGGCCATGAAGCACTTGGATAACGACGTTGATGGCACTCGTGTGAAAGATGCAGACGAGTCCTGGTTTGGATGCACAGTCATGTAAAC
CATCAACAGCAGCATTATTAACCGAGAGAAGCATTCTCCTCACGACTCTTGTCAGCAAAAAACTCGTGAAACCACCAGGTGACAACGCTGCTTTCTATGC
GCATCTCCAATAAAGGCTCCGACGAGTATTTAAAAGGAAATTAAAGTCGTTCCCATTTTTTTCGTTTCCTTCTCTTTCCATTCTGATGAATTCTCATGAA
CCCTTTTGTTAGACCACTACAAGTCTGACGGAAAAATTCACGTACCGTTAGATGGATGTTTTCCCGTTCCTTAATTCCTCTTCTGACCGATACACGTTCA
TCTTAGCCAAAAGGCCGAGAAGGATGCAAATGCTCATTGCATTGATAGGAACATATTGGTTGGGTTACGTCAGTTATTCGTCTTCGTGCTCACCACGTTC
ATTGGTGACGGTTGCAAAAGTTGGCGAGGCGAGTGTAAGCATCCGCCAGCACTTCGTGCGGTGCCGAGAACACGATGCGGAAATAGTTGGTCATTCCGAA
ACACTACGACAAAGTACGGTTAGTCAAAAGTTAGACAACGGGTGTATGAATAAACTGGAGCTTACCTGTCCGGGCAAGACGAAGACCGACTCCTCATCAA
GCAGCTTCTGTGTCAGATCGAAGTCGTCCTTGATCTTGGTAAGAACGTTGGTTTGGACTTTTACCTGCGAAGTATCGACGTAACAAACAATAAGTGATGT
TGTAGGAAACAGACACGACCATCGCTGCTACATACCATCACATACATCGCACCCTGCGGGACAACCACTTTCAAACCTGGAATCCTCGCCAGGGCGTCGA
TAGTGAACTTTGCGTTATCCTCCAGGGCCGCGAAATACTGCTTCTTAAACTCAATCAACGACTGCTCTTCGGCACTGCCAGGAACCGGCGTCAGCAAATC
GGGGATGGCACTCTGGTGATATCAGCATCAACATGTTAGCCCAGTTGTTAATATTAACGTTGCAAGCTGACCGCATATTCCATACCTGGACTAGAGAGTT
TGCGCCAAGGATATTTTGTGACAGCTTGAAGTAGGCGGTGCGTACATCTTTCAGGATGTCATTGCGGTCGTGGACCATAACCCAGCCTACTCGCCAGCCA
GGGATGAGGAACTGTTTGGCCAAGCCACCGACCGCCACCACCGGAACTGTCTTCGTCAAGGTCGCAATGGGGAAGAACACGTTGCTCCCGAACACCATGT
CACCATAAATTTCATCCTTGAATTCGAGTGAAACAAGTTAGAAGCTAACCTTGAAAGGCAATTATGCAAGGTTAGGAATTTACCGCAATAATTGGGATCT
TGTTTGCCTCCGCCAAAGCGAGGATGCTCTCCAAGTGAGGCTACAATAACGAAAAAGGATAAGTGAGTGTAACCTACTTGACAATGATCAATAGCGTTGT
TCCCTCACCTTTGAGTACACGCTGCCGCACGGGTTCGAGGGGTTGTTCACCAGTATAGCCTTGGTGTTATCGTCAACCAAGGACTGCATATGCTCCAGGT
CGACCTCCCAATTGCACTCCGGCTACATGAAAATGGAAGTACACAATCGGTCAATAAACGTACTCGTCGCAAAGAATTGTGAACTTGCAGGTCTCACCTT
GAGATTGTAGAACCTGCACTCGATCTTCTGTGCCTCGCAAAGTGCTTGGTACAACGGGAATCCCGGCTTCGGGAGCAGAACGTTATCACCGGGGTTCAAC
AGGCCTCGTAGAGCAATCTCAATAGCACCCGAGCACCCGCTGGCGATGATGATATCATCCATCGTCAATGGGGCTCGCATGTTACCGTAGTGCCGTGCAA
TTGCTGCACGGGCTGCCTCAGAGCCAGCCGAGTGAATGTAGCCATTGTGTTGCATCGAACTATGAAGAACAAATACAGATGCAGGGAATTAGTCGACAAT
TTATTCAAAAGTGAAACAATGCTATCGTCAGCGTACCGAGTGTTGCGGACGATCGCTTGCACCAGCACGTCGGGGCAGTGCAGATTGCCAAACACCGTCG
GATCACCTGCAAAGACCAACACGCTCAAAATTTAGATTGCAGACCTGGGAACACTAAATTGCAGCGATACCCACCTAGCGACAGCGGGATCAGCGTCTTT
GTCGACGCAGCGGGCTTCTTGATGTTGTCCACGATCTTCCGAATGGGGTTCGAGCACAACTTGGAAAACTCGGACGGTTGCACATTCCACTGCAGTTTCT
CCTGGCGCTTGGCATCAACCATGGGAACGTCGAGAGTGGGGTCGTCGAAGGCAGTGCGCTTGGTCATGTCGATTGATTGATGATGAGGTCAATTGACAAA
TGAGATCCATGTTGCAAAACGGAGAAGACGCAAAGTCCCATGCCAAGGCGTGCAATCGAGCTGTTCAGACGCTGCTAATCTTGCTGTTGAGACGCACTGC
CCTATCTATTCCGCTGGTGACGAAGTCGACGTCGGCCAATCGCAGCGGTTTAACAAGTTGCTTTTCAGTGGTCGCGCGCATAGAGTTCAACCTAGGGAAC
AGTTCCATGTTGAACCAGGTGCTTGAAGCTAGCCAAACAACGACCTATGCATATCGGCAGCACAGTCTTGGCGGAATTGCGCCTGCTTCGACACGAGCTG
CTGCTTGATCGCCTCTTCCTCGTCTCCCAATGCGCCAAACAGCACTCCAAGGAAGTCAGGCTCCAAATCGTCACCTTCCCAGCATTTGGTTAAGACTGCC
ACCAAGTCAATACTTGCATTTGTAAGAAGCTGACGCCAATCTTCAACGTGATTTGTTGCCAGAAGCCGCTGTGTCTTCACAAAGACACTGTTCTCCAGAG
ACAACATCATCAGCTCACGACCGTCCTGGCCACTTGCCGCAAGAATAGCTGCAGCCGCGCTACTTTCATCTTCGAGTTTGCTGGGGACTCCAGTTCTGGA
CGATGATCGCAAGGCAATTAACCGTGACTCGCATTGCTGCTTGACCAGCTCTTCCAGCATCACACGGGCGTAATACGGCACCATACGCTGGTCAGATACT
AGTTGTTCTCGCACGCCGTCCCACCAGTAGTTAACGGCAATCGTGAACTCATCCGAGTCCACTTGATGCCACCACCCCTCGGGAATCATAAGTGCATCTA
CAGCAAGACAATCATCAGCGCATTAGTCCGACACGAACGGTTCGTTTTGAAGAGAGTACTGTACCTCCTGCCATGATTTCGAATCTCTGGGCGGATGCCT
CGGGAAATCGCTGGTGTTTCTCGAGGTCGGGCTGCACGATGTTGACTTGGCTATGATTCACAGACTTGGTGTGCACTGGGAACGGATACATCCTCGCCAT
GTCCGACGGAGGGTAGAGCGTGACCGTCTTTCGTCCGTACAAAACTACCAGAATATTTTGATACGCGTCGTAATGTAACGTCGTCCTGCCAGGCTGCACT
GTCATCCACAGATTCACTTGAGTCACAGGCTTGTCTTGAAGACACGGCGGTCTGCCACGTGCACAAATTACTCGTCAACAAACTGGCTGGCGAAATTCAT
CAAGAACTTGAGTGCCTTACAAGCAGAAGTTGTCCATAATCCTCGGCAAACTCGCCTCAATGCAGGTGGGACCAGGCTTGAGTACTTCAATGGGGCATTG
CGCCAAATAGAACTCCAAGTCATCCACCCTTTGCAACCAATGCGACTGCTTATTGAACGATGCTTGATAATAGTCCACAAAGTCGCCGAACTTGAGCTCC
ACGCTCTGTCTGGCCTTCTCATTGCCGTAGTAGCAGCCACTCGATCGCTCCTTGCACGCAATTTCCACCACTACCATCCGTCACAAGTTACTCGTCAACA
AACTGGCTGGCGAAATTCATCAAGAACATAGTCGCTATCGCACTTACAAGTGTCGCGATGAGACTCGTATGATTCTAGCAGGTGAACAGACTTCGGAGCG
AACTTTGGCAGGCGCGTGGGCTCCACGCACTGGAGCGCGAAGCCCTCGAGGTAGACCGGGTCATGGTTGCCCAGCATGATCAAAAGGAGCTCGTGGTGTG
GCGCACACCGGCCAAAAATGAATGTGGCTGCAACTTGTACATGTTGCTGGCCCGGTTTGTGTATTTGTATGCTGTGTCAATTCCTCATCGCTGTTTGCTA
TGATCTGTTGTTGTTGTGCAGTTATGGTGCTTGCTAAGTTGGCGCGTCATTCTAATGATGGAAGCGTAAGAGCTGAGTTCGGTGCTGCTGCAACTTCTGC
CGCAGACTTCGAGTGGCGTACGCAGTACCCATGACGTTGAGCCCACTTCTCACAGTCTTGTTCAGCACAGCGCGACCCACCGCCGTGCGAGCGGCAGAAA
CCTTTGGAAATGGCGCCCTTCGTGCAGTCTGGGTGCTGGCATCGCACTCCCCCACCGTGAGTCTTGCAGCAACCACGAGACTGCACAGCACGACGGCACC
CTTCAACAGTGCAGAATTTGACACCCCCATGCGCACTGCATTTGTGGCCGAACTGCGCAACGCGCTCGCAGCCTGCCTCAACGCAGAGTCTTCGGCCGCC
ATGACCCGAGCAACAGTTGTTGAAGCGCGCAAACTTCGTACAGCCTTCCACTTCGCAGCGTCGCCGGCGGTAGCGCTTCGGAGCAGGTGTCTCGCTTGCA
TCTTCGACCTTTGTAGTGTCCGTAATAGGCGCGTCTGATGAAGCCTTTGCATCTACCTCTGCCGCTGGCGTTGCGCCACTTTTGCCTTCCGTCTCCTCAT
TCCCTTCGCTTGCTGTTGCTTCGGCTGTAACTACTGCTTTCACCTCCAAGGATTCACTAGCAATAACCATGTCTGCAACCGTCACGGTGGGTGTTACACC
TGCGTCGACCTCTCCCGGAACCGGTTTCTTGTGCTTGTCCTTGGCAATCACGGCTGCCTGGAGAAGTGTATCGATCCACTCGCGCACAGGGTGACCTTGG
CTGTCTGTGGGAGGCTGTAAGACCGACGCGTCCACCTTAACAGACTGGGTATTGACCACCCTGCTCATTGCGCCACTCGTCAACAGATCAGCAAGTGTCT
GCAGATTTAGTGGTTCGCACCATGTCGCAGTTCTTGGTGTGCGCACACTAAATGGAGCCAAGTTGAACTTTGCTCAAATGCTCCACTCAGCGCTTACCGG
TGCGTTCCGTCGTACAGGTAATCCCGACGGCAGCGAAGCCCCACGTGTATGGCAATGCTACATCTGCTCGATACAGAACGAGGTTGTAGCTGAAGATTCA
TCGCCATCGTGCAAAGCGTGCGGAAGGCCGCGTAATCCGCCATGGTTGCTTCTCGAGGACGCTGACCTGCAGGTGCGACTGCATATCCCTTTACGATTGA
CCTTCTTTGGTACTTGAATAATAAGTTACCACGCTAGATTGCACTAGGATCTCGAATGTTCCATACCAGTGTTGGTGGGTCCAAGACCGTGTCTGTCGTC
GTCACCATCAACTACGTTCAAAGAGTCGTCACACTGCTGCGAGTGAAGTCCAAGCACAATGAGCGCGGACAGGAAGACATCAGCTTCCACGAGGTAGTGT
TAACCGCCTCGCAGTTGCAACAACAACTGGAAAGTCTAGATGCTGAGCAGGAAGAGGACTGTGTAGTTGATGACTACGGCATCTGTGGCGACTGCCGTGG
TGTTTTCCGTGTTGCACAGGGGGATCCACACTCACAATATGCCAACCAAGACAAGGTCACAGAATTGGAGAAGGAGCTACAGCAGCTCAACGAGCAGAAG
CAGAGGTTTACAAGGGAGAAAGCATACGTACAAGTGCTGGAGTGGACGAAGAAGATTGAGCTTAAGGCAAAGGAGCTTCAAGTCGCGAAACGCGAACTCG
AATTCCTTCGTCCTGTATTCTGCCCGTTCTGTGGGTGGGAATCCTCCCGTAGTACGGGCCGTACAGATCAATAAACAGCGCAACCCCGCATCGACCACCG
ACATGCAATAAATGGTACTGATTGGTTACTATCGACACTTGTCATGGGCGATGCCTTTGCCCATAGGACAGCTCGAGCCGCGCGTGATGCATGCGATGAT
CCCCCTAGATAAGGGGTCTTGGGAACGGAGCTGGCAAGTTGCATTTTCAAATTGGACGCGTGTGTGGCAAGCACAAAAAATATCACTACCAATATGACCC
AGAACGACAAAACCATCGTCAAGCAGCAAGCCAAGCTCCGGTGGAGCGTGCAGCCTTCGGACGTGTCAAAGCGATGTATCAACCCCATCCGGAAGATTGT
GGACAACATTAGAAAGCCTGCAACGTCGTCCAAGACTTTGATCCCGCTATCTCTAGGTTGGTACTGCACGTGTGAGACAGCTAGGGGACAAACTCATCTT
GTTCTGCAAACTACATAGGTGACCCCACGGTGTTTGGCAACCTGCATTGCCCCGATGTGTTAGTGGAGGCGGTTGTCCGCAATACTCGGTAAGCTACAAT
TGGATATTGCTGGAGACATTAAGACTGATAGTCATGAACTCGTTTAGGTCGATGAAGCACAACGGCTATATACACTCTGCTGGCTCAGAAGAAGCTCGCG
CAGCAATTGCGAACTACTACGCCAGCAGCAAGGCACCCTTGACGCCCGATAAAATTCTCATCACTAGTGGCTGTTCGGGTGCTATTGACATTGCACTCCG
AGGACTGTTGAATCCTGGTGACAACATTTTACTCCCAAAGCCGGGTTTTCCGTTCTACCAAGCCCTCTGTACACAGAATGAGTTTGAATGCAGGTTCTAT
AAGCTGAAGGTAGGTCTGTTGCTTATAATCGGTAGCTGCTTTGCATTGATACCTGTCGTGTTGGTGCAGCCCGAGAGTAACTGGGAAGCTGACCTCGAGC
ACATGCAGTCCCTGGTGAACGAAAGAACCAAGGCAATTCTGGTGAACAATCCGTCCAACCCATGCGGCAGTGTGTACTCCAAGGTAAGTGATGGCGTGTT
TTAATGAAATTCACAGCGCTAACGTCGTCATGCAGCCTCATCTCGAGGAGATCCTTGCTTTGGCGGAGCTCAACAAGATCCCTGTAGTTGCGGTACGTCG
CCTAGCTTTACCTGGTTTGTGAAGAGATCTAACGTACTGCATACAACAGGACGAGATCTATGGTGACATGGTGTTTGGAAGCAACACGTTCTTTCCCATG
GCTGCGCTGACGAAAACTGTCCCGGTGGTGACTGTGGGCGGGTTGGCGAAGCAGTTTCTGGTCCCTGGTTGGAGGGTAGGTTGGGTCATGGTCCACGACC
GCAATGACATCCTGAAAGATGTACGCACCGCCTACTTGAAGATCTCACGAAGTACTCTTGGAGCAAACTCTCTTGTCCAGGTATGGTATCTGCGTCAGCT
TGCAACGTTAATAACTGTGCTAACGTGTTGATGACCCCGCTATCAGAGTGCTATCCCCGATTTGCTGACGCCGGTTCCTGGCAGCGCCGAAGAGCAGTCA
TTGATTGAGTTTAAGAAGCAGTATTTCGCGACTCTGGAGGAGAATGCCAAGTTCACTGTGAGCACGCTATCTGAAATTTCTGGTCTCGAGGTGGTGGTTC
CTCAAGGCGCGATGTACTCGATGGTAAGCTCACCCAAACTGCGATTGAAAAATGCATGATAACTTATCGAATTCCATTGCATATAGATAAAGATCGATAC
CGGCGTCTTAACGAAGATCAAGGACGACTTTGACTTTACGCAGAAGCTGCTGGAGGAAGAGGCCGTCTTCGTGTTGCCTGGGCAGGTAAGTTGTCAGAAA
CGGCGGCCGAAACTTCTGCTACTTGTCAAGTTATCTAACTCTACGTGGTATCCGCAGTGCTTTGGCTTGACAAACTACTTCCGCATCGTGTTCTCGGCGC
CACACGACGTGCTAGCAGACGCCTACACTCGCATAGCCAAATTCTGCAGCCGCCATCAGTGAGATTGGATACTTTGCTGACAGCAAATTGCTGTATGGAT
AGGTGCGAATCAGAGTGAAGGCTTTACAACCAAATCATATTCGATCCTTATGAACCAATCACATATCTCTATCTGATTAACAACCAATCAACGCTCCGAG
CACATCGCACGCATGTTTTGTAAGCGCGTAGCCTTTAAAATTAAATATTCCTCTTCACATAAGTAATAACAAGTAGCAAAGATCAAAGTGTTAATACTCT
TAATAGCTGATACGTGAAACCTTGGCTTTGCATCTTTATACTGTTATGGGTGTACCAGCTGGCAAAAATCTACTCGAAATTTGTGCGCTGTTAGAAAAAG
AGGAAGAGGCCGTTCATAGTGAAAAGCCGACTGCCTGGCTGCGACTGACTCGCTCCTACCTCGGATACCATGACTGGACGAAGATTCCTGCTGCTGGCCG
CGCTGGTGGCTATTGCGTTGCTGCAGCACATGGTGGCGAGCGCGGCCGTCGACGGCGTGATCGTCGTGCGCGGCAACAAGCTCTACAACGCCAAGACGGG
CGAGCGTTTCTTCATCAAAGGGGTGCGTTCTAACGACTCAAAAGGATAGGAAGGAGCCGAACGCTAACAGCAAAGCACAGTTCGGCTCGAAAAATGACGG
GGAAGGACTAATATGGTATTTTACTGTGCTGCTCTGTAGTTGACCTACGAATACGCCGTGAGCGACGATTACTATGATAAGTACTCGAAGGCCGTCATCG
CCGAGAACCTCGCGGGCCTCAAGTATAACACGCTGCGTCTGTACAACATCAACCCCACTTCGTCATACAAGAAATTCATGACCGATATGGCCGCGCTCGG
CGTCTACGTCATGGTCTCAGCCTCGCCTGATAACGACGCCTACTACGGTAAATACCGCTACTCAACCATTACCAAGAAACTGAGCTGCTCTGGAAAGGTG
TCGTCGGGTGACGGCGCCAAGACTGTGGACCAGACCGAGACCTGCTACCCGGCTCTTCTACTTGAGTATGGCAAGAAGATCA