Description :
From Genome Similarity Track
Location :
Scaffold_59:1277- 2431
Sequence
1154 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCGTTTGATACTACACCATAGACTCATCGACAG
CCATGAAAGAATCCACCCACGCTTTCAATTGTTTCCATGAGGCTTCCAGCCTGTTGTTTGTGTTATTTCCGAGTGTCACCGTATTTTGGCGCTTATACGC
AGACCACATCTCACGGCAATTGTCCCAATTCCGGCGAAAGTATGCCACAAATGGGTGTTCTTCGCCGCATCGAACGGGTTCTCTCGTTGGCGTCCGGTCT
GTACCCGATTTCGCATGCCCAACTGTGCCAGACTCACCCCCGACTGACCCCGATTGACGGTCGTCTAAGTTCGGTTCACTCCCAGTTGGCTCCGGCGCAT
TAGACGTTAGGACGTAATAGCCAATTGACGCGAGGCGGACCATGTACCGCAAATGCTTCTCGTATTCTGCTTCAGTCTTTGCGTACACCAGTAAACTCAT
CGCACCCCCAAGTTTCTCCTTCTGGGTCTTCGAAAATCCATAGTCAGCCGAGGCAACCTCTTCACGTAGGTATTTCAGTACGTGAAATTGGCAGAGCAAA
ATAGTCACTCCAGAAAAAGCTTCTTCCAATACTGAAATCTCCGTGAAATCCTTATCCACAAGAATACACTGCAGCCTTTTCCACGCTGGATTATTAACTT
TTAATTCCTCCAGCGCCGTCAGTAAGGTAGTGTACCGCTCGTTTTGAAGCAAAGCGTGCTGGACGAACTGCCCCTTGCCAAACGTGTCATGAGCCATAAA
CGAAAAGACCTTGTACTTAGACCGATTCGTTCCGTGGGTGCCTCAGCTAGAACCTCCTTCTCGTGGAAAGCTTTATCTGTCATCGGCACTTTCACGTTTT
TGTAGCCGGGATTGTTCTTTCTGAATGTATGGAGAACCAGACGGAGATTTTCTTTGGTTTCCCGTTCAACCAATGCGTGTTGAGCGTACTGACCCTACGC
AAACATCAAATAGGTTCGTTAACTGTCGAAATGATTCCATATAAACATTACTAG