Description :
From Genome Similarity Track
Location :
Scaffold_296:12763- 15980
Transcript NameFunction/comments
Phyag_g4417hypothetical protein PHYSODRAFT_475011
Phyag_g4418hypothetical protein PHYSODRAFT_554371
Phyag_g4419hypothetical protein PHYSODRAFT_474636

Sequence
3217 bases(100 bases per row)
CGAAGAATTTGCGTTTGAGTAGGAAGGCTCCTCCGAGCGTAATGAGAGCGCTTACGATCAACGATCCCACGAACATCCCACCCGTATTAAGCGCCACACG
AAGCAATTGTTTGGCGTTAAGATTGCTGTCCGCATCCCACTTGTGCAGCGTTTGGTACAGAGCAATAGCCACCGCGTCGTTCATCACACTTTCACCAAAC
ACCAGATTAAACAGCAACGGCGGCGCGTTGAGCTTATCAAAGCAGCCCAATGTAGCCACCGTATCCACTGCACTAATGAGCGTGCCGAACAGGAAAGCCT
CGACCCACGACAGCTTGGTCACCATACCAGCTACTCCCGCGAGGTATAGTACTCCTCCCGTGATGGTCGTGGCGACTACAGTACCCAGCACAGCTGTACT
CATGATGGCCGGGAAGTTGCGGAAGAAGACCGTGCACTTGATGGAGAAGCCGCCTTCGTAGATGATCGGAGGCAGCAACACATTGAAGAAGAGACTGTTG
TCCAGGTTCAGGTGCGTGTGCAGCGCCGCGTGCTTGCCGCCCATGATCATGAAGAGCCCTACGAAGAGCCCGAACATGAGCGCAAAGCTACTCTGCGACA
CCAGCATGCACGAGTAGCGCCCTAGCATGTAGGACGCCAtcaccagcacgaacagcatgagcagcagcagcaccgcgtcCTCCATCGTGGTGGCCTGGGT
GAATTTGACTCTGGCTTCATTCGATTGGTGCAGCTCATATACGCGACATGAATTTTTAGTCACCACAAAACCGTATGATTTGCTGAACGCAAAGCACTTG
AATTCACTATGCTTTGATTATGTACAACACACAAatacaagttgaagtggaccgTTATGCTGTCTGCATCTTGCTGCCTTCCTGTGCATGGCTATCTGCT
GTATCTTCCTCGGTGACTGGTCTCGGATTCGCGGGAGACTGAAAACCGCCGAACATCGGCTGCATGTATGCCACGTCGAAAGTTTCCCACCTGCGGATGA
AGGCGCCAGTCAAAGTCTCGCTGCGCTCCGTCGGCGAGTCTCCGTCGAGTTCTCCCTCCTCGTCACTGTAATCCTCGTCTCGGAACTGCGGTCGCGAAGT
AAATATCGGATCTCTATCCGCCCCCGTCTCTTGGTCTGCTGTAGTGTTTCTCTCTGAGGTTGTTTGAGTGACAGGAGGCTCTGCAGCCCTGGAGTTTCGA
CGCAGCATGAAATGACGAGTGCTGCGTTGCAACACTCGCGCGCGATCTTCATCGGAACTCGAATCGCCTTCAGGGTTCGACTCCGGCTCAGATTGTCTCA
ATGCGCTGTGATGATTCGTGAGACGCAGTTTGTACAGAATGGGACCTGTCAGTCCTCCGATCACAATTGTTGTTAAAAGCACCACGATGAGTGTAGTGGA
CTCCACGAGCTGTCGGTGGGAGCCGTACCGACCAATGTAGTTCCAGTTCTTAGCGAGAGCAAACGCGATTGATCCTCGAAGAGCGACGAACCACATCACA
CTCATGTACTTGACTGGAATACGGTCGGAGGACTCTCGAGAGCAGTTGGATAGTCTTAAGAGAGGGAAGATGTTGAAGAATCGTGCCACAACACACGCTA
CCATCGTAAGGCCAATGAAGTGCCAGTCGATGTCATCCACgcgaagtgcagcgccagAATTCTTCTCTGGGTGTCCCGAAAAAATCATTATCACGGATGT
CCCCATGAAAACATACACGACGTTCTCACACACGAACGACAACGTGTGCAGCAAATGGGTAAATGCATGACGAGCCTCACGTGACAGCGCATTGAAATGG
TAGTGCGCCGTCATAGTTCCCGAGAAGAACAGCGCAACAATGCCGCTCAACTTGAAACTGTCAGCCACATAGTACGTGAGCAAACTGAAAATCAAGCACA
AGCAGATCTCGTAGCTGGGGAAGAAGtgcagcgacgagaagatttTGCGCTTGAGCAAGAAGGCACCGCAAAGAGTGATCACCgcactcaccagcagcga
cccCACAAACATCCAACTCGTGTTGATAGCCACTCGAAACAACTGCTTCAAACTCAGGTCAGTGCCAACATCCCACTTGTGCAAGGTCTGGTACAGCGCA
ATAGCCACTGCATTATTGATCACACTCTCTCCAAATACCAggttgaacagcagcggcggcacgTGCAGCTTATTGAAGCACGACAAGGTAGCGACCGGAT
CCACCGCATTAATCAGCGTACCGAACAGCAAAGCTTCCACCCACGAGAGTCTCGTCACCATTTTGGACGCTCCGGCAAGGTACAGCACGCCACCCGTGAT
AGTCGCCGCCACAACTGTACCTAGCACAGCCGTGCTCATGATGGCCGGGAAGTTGCGGAAGAATGCCTGCCGTTTAATGGAGAAACCTCCTTCATAGATG
ATCGGAGGCAGTAGAACATTGAAGAAGAGACTGTTGTCCAGGTTCAGGTGCGTGtgcagcgctgcgtgctTGTCCCCCATGATCATGAAGAGCCCCACCA
CCAAACCGAACGCCATCGCGAAGCCGCTCTGCGACACCAAATTACACGAGTACCTGTCCAACACGAACGACACCACtaccagcacgaacagcataagcag
cagcagcaccgcgtcCTCCATCGTGGCCGCCTCGGCATCTCTCTCGGGCTGCATTTTCACTTATCATGGCGATGGGAACTGTGCGGCACAGGAAGCCGGA
GCTCATTTTTATCGTTAAAACGTTACGAATTATTGCTTAAACGGACCGGCTGTTATTTGGTGTGACGAAGCAGCTGTAGACGAAAAAGCTGCAACGTCAG
ACATGCCTCGTGAAGTTAGCGGTGCTCGAATCTCGGGGCGCGTCGAGGTCTGCCACCTCCCTTCTTGAAGCGCAGGATGCCCATAACTAGAGCCGCGATA
CTGCAACCAAACCTGTACGCATCATGTTGTTAGTGTCAAATactcgttctcctcttccagAAAGCTCTTCCTTACCAGGTTGCGGCGTATCCGGCATGCT
TTTCGGGCGTCATGTAGAACTCCAAATAGGAAGCGATGTTCTTTCGGAGAGGgttgtccagctccacctcgcCATTAACCCCGTCaacggctgcagcaag
gaATTGATCAAGTTAAAACGTGCTGTTAGGTTTCTAGAGAAGCCACGCGAAACGTACCGAGTGCGTCAACGACGACAGGAAGATCGGTCGAAGTGACGCC
CATGGCGTTGGCCATCT