Description :
From Genome Similarity Track
Location :
Scaffold_1:1276211- 1279074
Transcript NameFunction/comments
Phyin_T30-4PITG_00197Putative uncharacterized protein

Sequence
2863 bases(100 bases per row)
ATTGTGTTGGCGCCATTTTTCTGGAGAATCTGTACAGCCTAAGCCTGGATGAGAGCACAGTGGGAAGCAGCGCAGGCGGGACTGCGTGTCTTCTTGGAGG
AAGATGGCGAATATGCAAACTTCCTGGAGAGTATCGAGAAAAATTTGGCGCGGAAGCTGCGCTTCGAATATCAATCACGAGGTGGATCTCATGTGGAGAG
CGTCGCCTTCGACCGGTTCTTAGAGGTCGCCGCGCAGATCTGGCACATTCACGCGTTCTTCCAGTCAAAGCTGAGGGCAATTGCCGAGCCTTTGGCACGT
GGACCTGCAGGCTCAGTCGAGGAAAAATGCAACAGCTTTGTGGAGATTCTGGCGGATATGCTGAGCCTCCTCCGCATGCAATACGGGCAACTCTTTTGTC
GACGTGAAGCCACTCAAGCTGCATTCGACGCAGCTTTAGCTAACAACATAAGAGAATGGGACGGTAAGGTGCTGGAAAAGTATCTGGCGAAGCAGCAGCT
GACTGCAGACAAGCTGGTGGATCGGCCATTGCAGCGATTCGAGGAACTGGTAGAGTTTGTTGAGGCGCTGAGTAAGACTCTCTCCGAAGATGGCATTGAT
GGAGCTCTAAGCAATGACAGTGATATGGGTACTGAAGAGAAACTCAACTATGCTCCCCAACTGATGCATATCGTCCAAGAAACCAAGCACTACATTCACC
TGGTCAAGGCAAATGCACGCGAGGAGAAAGAATTAATATCGCTTCAAAGCTGCTTCTACGGCGACGGAGCTGAGGCTTTCCATGATTTGTCGGACAATAA
GCTGCTTCTTCACGGTGAAGTCTTCTTGTCGCAAAGCGATCGGAGTGGAGCTGATTCAGAGACTGCAACAAGTATTACTGGTTCATTCTCCCAGCCAGAA
GATCTTTACCTTCATTGCTTTCAGGATGGCACGTTAGTTTGCAGCAAACGACAGTGCTCTGAGTCAGGATCTGCGTTTACCATCCTGCGCCGTCTACATC
TCAAGCAGGACGCGGCCTTTCTGGAGTTTGTTCCGTCAATTGTGCCGATACATGAATCTTTAGAAGAAACGTGTGCTTTGGCACTGATTCTGCAAGACAC
AACACTCGTCTTTTCCTGGAGAGACGCATCGGAGTATCAGCAATGGTCTGATACTATTGGGGGATTTCTGGAAATGAATGGATCACGGGCTGAAAATCTT
CACCAAGGCCGATCGATTGATGCTCTGCCAGTACCTGAAGATATTTCAGCGCAGCTTGTAGAGACCGATACCATACCGACCAAATTTGCCTCGTTTTATG
ACGATCATCTTCCTGGCGTCTTCTGGATGATGATTGATGACGCCAGCAAGTCACGTTGGGAATTGGTCGAAATTGTCTTCTATGTTAGATGGCTGGTAGT
TTTCAAGCTCGACGGATGGAAAAGGCACTCAGCTTTATGTCAATTTGATACGCATGCACCTGAGATTGAGATTAGTGAGCAGCCACGAGGAGATAAAGAG
TGGAGCTTGGTCATTTCGAATGGATCTGCTGGCAGTCTGACACTCGTATCGAAGAAAAGGACTAGAATTGACTTCTGGTTTGATCAAGTGTGGAAAGCCA
TCGAGAATGCCCAAGTTGAAACTAGACGAACTGAAAGAGAAAAGAGGGAGCGAAAAGAGATGGAAGAGGAGGAACAATCTATGCGTGTTGAGAGGAAGAA
GCGAAAGTTGCAGACGGTATCTGACAAGGATGAAAGTGCCGTTGATGCGACACTAAACTCTTCCTCCAATGCAAGTCCAGCAGGGTCTAATAACTCGAAG
CCTGATGATAAAACGGACGAAGAATATGGTGAGCTGGATAAGAGTACATCAAGTATCGTTGTGGCAGAGGAACTTATCGCAGCACTGCCAGTTAGCAAGA
AATCCCGACGTTTATCCGACAAACCAAAGCCGATATCTGCTGCGGCTTCCGCCGAAAAGGACACTTGTACCTCTTCCATCGTCTCGCCAGCTGTGACAAC
TCCGAAGAGAAGATGGCTGAAGAGGAAGTCTGAGGACCCTGACGACACGGCCTTGATACCGACGCAACCAAGCTCAAGCATCCCAACTGATGAGACTACG
AGTGAGATTGATACCTTGCAGCTTCCTGCCAACGAAGCAGCTGCTGAGGAGCCGAGGACCCAGGAGGTTCGGATTATCCTCACTGGTATTGAACCTACGG
CTGCCATCCGAAAGAAAATCGATTCGATTGCTGGTGCTCTATACGAAGAAGACATTGAGAAGGCAACGCATATTCTGGCCCCGAAGAACCAATTAAAACG
AACGGTGAAGCTGCTGTGCGGGATATCGCGCAGCTCTCACGTCCTGGACGTGCGGTGGTTGGACGAGTCGGCACGTGTGGGCGCTCCTGTCTACGAGCGA
GCTCATTGCTTGAAGGATTCGAAAGCTGAAGCGAAGTGGAAGTTCGATTTGTTAAAAACCATGTACGACTATACCCCCGAGCAGCGGCAACAGCTCTTCA
CTGGACATCGGGTGTTTATCACCAACCACAAGTCAGTACTTCCGCCGGTGAAGGACCTGGTGAAGATCGTTGAGTGCGCCGGTGGAGTTGCTGTGACCAA
AGGCAGTGCCGATCCGAACGACGTGGTCATCACGAGCGACGCGGCACTGGTCACGGCCTCGGTTCGCAAGGCACTGACGCAGGCGAACCCGCAGCGGATC
TACTCGGCTGAGCTTATTTTGAGTGGTATCTTGCAGCAGCACATTGATTTTGACCAGAATCGTCTGGAGCAATCGGGTGGTGGCAGCAGTCGCCGACGCA
GGTAGACGTCGGGACTAGCAATTTAGATCATCCATGATCGGCTGAAAAAATACAAGGCGACGG