Description :
From Genome Similarity Track
Location :
Scaffold_66:127611- 128764
Transcript NameFunction/comments
Phyci_105756Monovalent Cation:Proton Antiporter-1 (CPA1) Family

Sequence
1153 bases(100 bases per row)
TCCTGTTCCTGGGGCTGCTGCCGCCGATCATCCTGGAGGCGGGCTTCAACACGCAGCGCAAGGGCTTCTTCAGCAACTTCTTCGCCATCCTGCTGCTGGC
CATCGTGGGCACGCTGCTGGCCACGTTCGCCACGGGCGGCATCCTGCTCTGGCTGGGCAGCCTGGGGCTCATCACGCCGCTCACGTCGGCCGAGGCCTTC
CTCTACGGGTCCCTCATCTCGGCCATCGACCCGGTGGCCACGCTGCTGGTCTTCAAGAAGTGCAGGGCCCCGTCGCTGCTCTTCAACCTCGTCTTCGGGG
AGAGCGTCCTGAACGACGCAGTAGCCATCGTCATCTTCACGCTCTTCCAGAGGCTCGTGGAGAGCGGCAACTCGGACGTGAACGTGCAGGTGGCCGCCTT
CATGGTCTTCCGGCTGCTCAGCATCGGCGTGGGCTCCGTGGCGCTGGCCGGCGCCATCTGCTACTCGTCCGCTTACTTCCTGCGCCACTCGGACCCGGCG
CTGCGGCAGCACCCCATCTACGAGATGTCCATCATCCTGCTGAGCTGCTATGCGAGCTACCTGGCCGCCGACCTGTTCGAGCTCAGCGGACTGCTGGCCG
TGTTCTTCAGCGGCGTCTTCATCCGGCACTACCACATGTACAACATCTCCAAGGCCAGCGCCTTCGCCTTCAAGCAGCTGCTCTCGACCATGGCGTTCCT
GGCCGAGAACTTCATCTACCTGTATCTGGGGCTCAGCGTCTTCGCCTACCGCGACTCGTTCGTCTGGGACTGGGGGTTCATCTTCGCCAACTTCGGCGCG
TGCTTGCTGGCGAGAGCGCTCAACACGTTCCCGCTGTGCTCGCTGGCAAACTTGGGGCGCTCGGAACAGCAGAAGATCCCGTTCTCGTACATGATCGTCA
TCTGGTTCTCCGGCCTGCGAGGCGCCATTGCGTTTGCGTTGGTGTTGAATGTGGTGACGGGGGACCCTGTTCACGCGGCCATTCTCAAGAGTTCGACGCT
CTTCCTGGTGCTGTTCACCACGGTTTTCTTCGGCATGGCGACGGGGCCGCTGCTGCGTGTGCTGGGGCTTACTGGGGACCCGCAGCCCGAGCAGGAAATC
TCGACTGGTGAGGACGCCTTCACTGGCGAGGCCGACGAGCAGCAACCGCTGCT