Description :
From Genome Similarity Track
Location :
Scaffold_1921:1276- 6426
Transcript NameFunction/comments
Pytiw_DAOMBR242034fgenesh_masked-piw_contig_1921-abinit-gene-0.2Callose synthase

Sequence
5150 bases(100 bases per row)
AGTCCGATCAGCTCCATCGCCTTGCGGTAGTGCGACGCCGCATACTCCTTGTAAAAGTTCACGAGCGTCTCTCGAATGATCGCGAACCCTCGTCCAGTGC
CGCGGTATTTGGAGCCACCGCGCATGAGCGCAACGTCGTAGAAGTGGGCCTTCGTGCCCGTCTCGAAGATGTAGAAGACCGGACCGAGCGTCACGATGAG
CTCGACAAAGTTGACCACCGCCTGGCGCCAGCCGTATTCGACAAAGAGCGTCGCGATGAGCGGGATCGTCATGAGCATGCCGAACTGGAAGATGAACTGC
GTGTTGAGCACCTTGGCGAGGTCGTCCACGACGTTCGTCTTCGTGATCGCCGTGTGGCCGATCTCCCCGTGGAGCGAGATGTACACCTTGGCGTACGCGT
ACACGAAGACACAGAGCACAGTGAGTGCGTTACAGATGTAGAAGCCCATGTGGCCGTAGAACATCGAGTTCATGCGGAAAAAGTCCATGCCCGCGCCCAA
GCGATGCGCGTCGCGACTCAGCGAGCTCTCCGCCGATCCGTTTGCCAGCTTGGCCTCGAACGCGTTGATCTGACTGAGCGTCACGTCTCGTCCTTTGCCG
CACTGCATAAACTCGATGTGCGTCACGGTCTCGCCACGGAGACACGCGTTGTAGCCACTGAAGACATCCTCTGACAGGTTGATGCCTTTGCTCGCCTTGG
ACACACCGCCATTCGTCATGATGAAACTCTTCTCAAACACATCCGGGTGGCCGTAGTGCATGCGCGTGCGCAGGGGGTGCGCCATCACACGCTGCGTCAG
ACTCACAAACACGAGCTCCTGCAGCGTCATGAAGCGCGCCAGCGACGACGCGCGGCCCGTGAAAATGTGCTCCTTCATGCCAATGATCGCGACGTTCTGG
CCGTCTTCCGTGCCACTGGCCAGGAAGTTCGGGATCTTTAGCGCTTCTTCAAAGTAGTGCTCCTGGTTCATATCGATCGTTTGCACGTACTCACCACGCG
TGAACGGGAGCGCAATGTTCTGGTTCTCAGGCTTGCCTTCGCCCACGAGTGGGTTGCCAGGCAGTTCGTACCGGTATACTTCGACAATCTCATCCCCGTC
CGACTTCACCAGCACGCAGTCGTATCTTGGCTCGGTACCGCTTCCTGCAGGCGGGCGGATCGTGTCCACGTAGCTCACACGCCAGTTCGGGTACTTGCGC
ATGAGCAGGTCAATGTCAGCCGCTCGGCTGTCTCCAGCAGCGAGCTGCTCGGAGTAGATCTGGCAACTGGTCACGTACGAGAACTTAAGACCAGCGATGC
GGTCCATGTGCTTGATCTTGTCCAAGTGCGAGATGTTATCGTCCGAGCCGATTTCCAGCCACCGCAGCATCTTGAGCGCGTCTTCGTACATCATCATGCC
TTGGACCGTTCGCGCGAGCGTCTGACCGCGCATCGACGCCCAGAGACGCACTTGAGTCGGTGTCTCAGCGAGAGCTTCTTCGATCGACGTCGCACCGACA
CGCTCGAGGAAGTTACCCCACTCGTCGCTGTGGAACGTGATGAGATACTTAAGAATGCTCAGGTCCCGACCCTTCGCCTCAACTTTCTGGAAGAGCGGAT
TCGCGGTCACGCGGCCGTTGAGCTCGTCGATCGAGTACAGCACCGACTCGTTGTAGTACGGCGTGATCACGGAGAACGAATGCATGGACGCGATCGATTT
GATCGCCGGGATCTTCATGCACAGCGAGTTGAGGAAGAAGCTCATGCGGCGCTGCGCTTCGTGGCATCGAGGCAGCGCGTCGGCGGCGTCGAGGGTCAGC
AGGAAGAACAGTCGCGTCGAGAGCGAGATGATGCTCTCGTTCGAGCTCGGAGAGGTCCCCGGGCCTTCGTTCGAGTCGCGCTGGCTGATGCGGTCCGCAA
AGATGGAGAGCAGCTGTCTCTTCTGGTAGTCGAGGTCCGGGGTCATCTTCGCAAAGACCGACTGGCGCAGCTTCTGCGCCATCCACTCCTCTTCGAGCAT
GAGCTCAATGCTCTTGAGCAGGGCGTCCACGCGCTGGATAACCACGACCACCTGGTCGTTTGGGAGCCCAAAGTTGCCGCCGATCGGACTCACCGAGGGC
TCGGGCAGGTCGAGGATGCTCGCCAGCAAGTCCACAATGTTCTCACGCACCAGCGGGATGTGGATCAGGTTGACGACCGAGTGCACGCGTCCGGCCATGA
GGATCTCTTGGAAGACGGAGATGATTTCTGCATCCTCAGGCCCGAGCAGCTGCCGCAGGATCTGGAAACCGATGTCAAGACAGTTCTTCGCGCATCCAAG
CACGCCCGCCTTGTTGAACTCCTTGATTAGCTTGGCATCGTCCAGTCGGCGTGTCTTGGCCTTCGCGGCAATGTCCGACGCTATCTGCGCCTGACCAGCA
ATTAGGAACACTGGGTCTTCAACAGAGCCCGAGTCTGAGATCTGGTACTGAAGGATCGCAGTCTCGCGGTCGTCCAACAGGTCCGAAAGACGGAAGCTGC
TCACGATCTCGTTCCACACAACCGCAAAGCGCAGGCGGCTGTTGGCTTCTGGGGAGATCACGCTCGCAGATAGCGGGCTGTCGCCATTGCTCGACGAGAA
CTGACCGCGAGCCACGGCAGAGACCACCTTCTCGTCAAAGAGCTGCGGCGCCGCCTTGAGCCGCTTGACGAACTCAGGGATGCGCGACGAGTGGCCGATC
TTGAGGCGGATGCCGATGAACATGCCCACGATCGACTGCATGATGGCGAGCCAGATCTGCGAGTCGTAGATGTACACGAGGAACACGGGCGCCCACATCG
CGATGAGGTACGCGAGGTTGTGCTCCGACTCGAATATGCCGTTCTTGAGCTGGTTCTCCGAGATCTTGATGTCGTAGATCTCGACGGTCGGACCGATGAG
CGGCTTGACCATGAGCTGGAGGTTGAAGAGGAACTTGAGCACGAAGATGACCATCCAGAAGAGCCCGTAGAGGAAGAAGCTGCCCCAGGTCTGACCCATG
TTGCGGCCAATGTACTGCCCACCGCGACCGTCCATGGCATTGAGCAGCGGCGTATTCCAGACCCAACCGCGACAGAGCATCTGCACGATCGCGACGAGCA
CGACCGGTGCCATGTACGCGCCGGCGATGATGTAGCCCATATTGAGCATGTTATCCGAGCCCATCAGCACTTCGTAGGGTGCGGCGTTGATGACAGCGAA
GAGCGCGAAGAAGATCGAGTGCCACACGAGGCGACAGAAGACTACGGCTGCATAGGCCGCGCGTTCGAAGATGAGGAAGCCACCGATAAAAATTTCGATC
GCCACCTTGAGCACCAGGAGCCCCGAGACCGTGAGGAATACCGAGAGGAACGCGTGGTTGCGGATGTCTTTCACATCGGCCGAGAACATGCGCTCGTAGA
AGCGGAAGCCGTTCCTGCTGACCGGGTCCGACCGGAACGCGACGTACGCGATGACGATCAAAATGTGGAACATCACGAACAGGAAAAAGTAGATCCGGAA
GAACGCGAGCAGGGGGTTGAGGAAGGTGCGGCGCTCCTTGAACGTCTTGTGCTCCTGCAGGTTGATCGCCTCGGCCACGTTGAGCTCATCAAAGTCGAGG
CAGCGCTCCGACCAGAAGAACTCGTTCACGTCGTCGTAGTTGGTGATGTTCTTGTGGTCCGGCGCGCGCTCACCCTTCTGGGGCGTCGTCGCGGCGCGCA
TCTTGGCGACCACGAGGTAAAGCGGCCGCACGACGCGGCGCAGGAACGTGCCCTCGGGCACATTGGGCAGCTTCTCGATGCCGTCAAGCTTGGACGCGAG
CGAGTGGTACAGGAAGCAGAGGCACTCGGGCATGAAGCGCAGGTTGCCAGCCTCGCCCCAGATGAGCAGGAAGAGCGCGATCTGGCGCTCGGCGACGTCC
TGTTGCGGCGCATTGGTCGGATCGAGCTGGTACGGCTTGGTGTGCAGAAACTTGCACCAGCGCGCGTAGTTCTTGAAGAACTTGGTGTGGATGAGCCGCA
CCGAGTCCTCCGTGTCGGCCGTGACCTTGTTCATCTGCGCGCGAGACTCGTAGTTGAGCACCCAGCACTCGTAGTGCTCGCGCTGGTTGCGCACGTTGCC
GTCCTGAAAGCCAAACTTGGCCTGTAGCATCTCAAACACGCCATGATTCTGCTGTTGGGCGGCCACGTCCTTGCCGGTCGCCTTGCGCTGTACGACCTGC
TCCTCGACGCCCTGGTAGTTGGACTGCGCGCGCCGGCGCGGCGCGAACGACTGCGCGCGGTTTGCGACGCTCGCGCGGCCGCTGCCATTANNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCGTCAGCTGCTG
CTTCATGCTGTTTTTTTCTTCTTACGTGGTCTTGTTAGTGATACCGACTGGAGAGCTCTTTTTCAGCTCTTCGGAAAGGTCGAGTCGGTCCCCTTTGCCC
ACACACACACAGCCACACACACAGAGGCGCGTGTGGACGTACGTGTGGAGGAGCTGCTGCTTGGACGACACGGGAGGATGGCGAGTGGCTGCTGTCGGAT
GGAGAGACGCGCGCACGTGGGAGTGTCGGCGGTTGTCGCTTTGGCGCTTTCTCGGCTTTTTCCTCCTTTCAAAAGAAACCCAAGATGCGGAAAAAAAACA
GGCAGCATCGCGTGGTTCGTGCCCAGAAAAACCTCTTTAAACACAGATACTCATTATACGGGGTGTTGTTTGACTTGTGAGATGTATAGTTGATATAGTT
TATATGGTAGCCTGTTTAGAATGGGAAGAGTGGGCTTAACAAACAAGCGGAGGCGAAAGAAGCCAGTCACAAAGACGTCAGTCCGAAAATAGCACGCCAT
CCCCCTTCAGTTTTGGGTTGGTTGGTGTGGCACTGGTGTGGTTGGTGACTCTTCGTCTCATCTCAAGAAGCAAGAGGCACTTACTGGTAGCCCCAATATA
TAACGTACAGGCTTAACGCTACTCGCTCTCTTGAAGCCTCATGCAACAAG