Description :
From Genome Similarity Track
Location :
scaffold_1410:1276- 3076
Transcript NameFunction/comments
g11378.t1 hypothetical protein PHYSODRAFT_508709

Sequence
1800 bases(100 bases per row)
GCTTCCAGTTCACTTGTCAATTTCCTCCGAACCTCGTAAACTCCAGTTCACTTCACTATGCCGACCACGTTCACCGGCGGTCGAGCCGTGAACAACCAAG
ACCTTGACGTTCCCAAACGACTTTCCTTTATAAGTGGAGCCTCACAGCCGAAAGACCTGGAGGACGGGAGCTACGTCGGAGTTAAAACTCCCGACCAAGT
ACCGATCGGTGCTCGCCCCGTCGAAGGTGAAAATGGCGCCATCCGTGAAGGAGGAATGCCCGTACTCACCAGTAAAGAGAACCTCGGTCTGCTCTTCGAG
TACGCAGCAGTTGGTCTGGTCTACGGTCTCCTACCGGAAACCATCTACCCGTTCATGCAAGAATACCTCAACTGTTCCGGTTCTCAAGTCACAGCCGCCA
GTCAGTTGGTGGTGCTGCCGTGGAGTTTCAAGGTTTTCTACGGTATTTTATCCGACTGCCGTCCGATCTGCGGCTACCGTCGACGACCGTACATGCTCAT
TGGCTGGGGAATCTGCTTCATCATGTTGCTGGTCATGTGCATCATGCCGATCGGTAAGCCTTACTTCACGGACGCTGCGGATCGAGACGTTGATGTGGAT
GACTACACACCGGAGATTGAAGCGCGTATCAACTACAACGCTCCATCGGAAGGCGCTAAGTACGTGATGTTGATGTTCTTTGCGGCGTTCGGCTACGTCA
TGTCGGACGTGTGCGCCGATAGTATCACGTGTGAATTGGCGCAGCGTGAGCCACTGGAAAAACGTGGCAAGACCCAGTCGTGTATCTACACAGTTCGCAC
TGTGATGGTCATTTTCGGTGAGCTTCTGACTGGATTCTTCTTCAATGGTGAAAACTACGGCGGCACCTTTAACTTCTCTCTCAGTTTCCCCCAATTGATG
ATCATTGTGACGGTGCTCACACTCCCAGTGTTCCCTATGACGTGGTTCTTCATTAAGGAGGAAAAAGTGGAGCCTGCCAACTTCAAGGAGTATATGAGCA
GCTTCTGGGATTTATTGTGTACTCGAGCAGTGTACCAAGTGATCGCGTACAATTTCTTCGCCAATATCTTCGCTGATATCACGTACACCGGCAGTTCTCC
CATCCAGGATTACATGGTAGGGGTTACCCCCATCAATAGTACACTGAGTGACATCCTCAGCAATCTATTGTTCATGTTTGGCATCATGATCACGTCGAAA
TGGGGTCTACACTGGAACTGGCGCTGGATGATTGTGGTCACGGGTGCTGTGGTGATCATTGTGGACTGTACCGTGACGATGATCGTAGTATGGGACGTGT
TCCGTAACCAATGGTTCTGGTTGGGTCCTCCTATTGCCGTACAGCTTCCGTACGGTGTTGGCTGGATCATTTCCACTTTCGTGACAGTCGAATTGGCTGG
ACTCGGCAACGAAGCTGCTGTATACGGGTTAATTACTACAGTGACCAACGTCGCTTCCCCCTTCGCTTCGGCTTTGACTCTGGTGATCGATGCTCCGTTC
AACATCACGAACGCTCGGGTGCAGGAAGACGACTACACGATTCGTCGAAATCTCACGTACACGATCGTCATTATGTACGCCATGACGGCCTTCGCGTGGG
TCTTTCTGTTCCTGTTGCCCAAGCAGAAGGAAGACACGCAGCGACTTCTGCGCAAGGGAGGCAAAAGCAAACTCATCGGTGGGATCACAGTCTTCTACTT
GTGTTTTGCGATGGTGTGGTCTGTCATGACCAACATCATGGCTATCTTTACTAGCACTGCATGTCTTGTCATCGCTGGGGGGTCTGGTTGCTAAGTGCAT