Description :
From Genome Similarity Track
Location :
Scaffold_1:1275938- 1277606
Transcript NameFunction/comments
Aphas_H257_00425Hypothetical protein

Sequence
1668 bases(100 bases per row)
AATGAGTTTGAGGACGTCTTCCCTGACGAGGTGCCCTGCCGACTCCCCTTGGAAAAGGGCGTTCAACACGAGATTGACCTCGTGCCCGGCGCGAAATATT
GCGTCACGCGGCAATGGCCGCTACCTCGCGACCAAGTCGACGCCATCGACGCATTCATCGGCGAGTCACGTCCGCGAGAGCATTTCCCCTCACAGCAGCC
CGATCTTCTGTGTGAAGAAGCCCGGTGGGAAATGGCGTATTGTACACGGCATTACTGTTAAATCATTTAGAACTGTTTCTCAAACAGTATTCATACATTT
TTTATTGTTTTGACAGTTAACAAATTGAACGCGTCCACGATTCCGGCACAGACGCCGATTCCTCGCAAAGACGTTATTATCGACGGCATGGGTCGATCTA
CCATTTTCTCAGCCATCGACCAGCGCGATGGCTTTTACCAAATCCTGATGCGTCTGTGTGACGTCCCTAAAACGGCAGTTTCTACGCCGAGTGGCATGTT
ATGGGAGTGGCTAGTCATGTCACAGGGTCTCTCCAACGCCCCGGCGACGTTCAACATGGTCATCGCGAAGTTCCGCGCGTTTTGCGGCTTCGCCCCGTCG
AACTTTGACGACATTTACGTCCACAGCTGCGCTTCACCAGCGCAGTCCGTTCTTGACGTTCACCGTGGGCACCCAGGTGTTTGAAGTCCTCCGTGCCAAC
GGACTCTATGCCAACCTCGCCAAATGCATATTTGGTGTCGACGAAATCCCACTCCTGCGAGATTTGGTGGGGGTGAACGGATGTCGGGCTGATCCCGAAA
AGATATATAGATAAAGACCATTTCGGAGTGGCCTATTCCCTCCATCGACAAGGATCTTCGTCGCTGGCTGGGCCTTGCGACGTACCTCCACAAATACTCG
CCCAACTTTGCGAACATCGCCTAGCCGTTGTTTCGGCTTCTCCTCAAGGATGCCCCTTGGGTCTGGGATTCCGCTTGTCAGTCGGCCTTCGAAGGCCTCA
AAACCAACCTTCAACGCGCCCCGATCTTGGCGCTCCCGGACTTCGACAAACCTTTTTCCGTCGTCTGCGACGCTTCGCAGTTTGCCATTGGTTGCTGCCT
TATGCAGCTCGACGCCTCCGGTCGCCCTCGCCAAGACTCCTACCAAAGCCGTCAACGCCATCCGGCTGAGCGGGCGTACCCGGTTCACGATTTGGAACTT
CTCTCCATGATGTACAACCTCACCAAGTTCACCTCCTCGGAGGTAAATCCTTCGTGGTTTACACCGATCATGCGTCCTTACGCACGGCGACGAACACACC
GCACCTTTCGCAGCGCATGGCGCGCTGGATTTCGTTCTTCTCCGAATTCACATCTTCGGTTCAGTACAAGCCCGGGAAGGACAACATCGTGCCGACGCCC
TGCCTCGGCGTCCTGATCTCGAACTGACCACGATCGATCTTTTGATGTCCGGTCTTCACGATAAAAACCGCGCGGCGTACCCCTTTGACGCTGATTGCTC
GTCGCGCCTGGCGGCACTCACCGACCCCGTTTCCCCGAAACCACGCCGCGCTTCGTCATGCTTGCATCGCTTCGCCCTAGCCGATGGGCTTTTGATGTTC
CAACCCACCGCGGACTCGCCCCCGCACATTGTCATGCCCGGCGACGCGCAGCTGCAAACGTCACACAC