Description :
From Genome Similarity Track
Location :
Scaffold_24:12757- 16258
Sequence
3501 bases(100 bases per row)
AAGGAAAACTTTGCCCTTCTCGTGAAGTTGCAGCACCCGGCAGATTTTGAGAGTACTCGTCGCCGGGTTTGGAGGAAAAAAAAGCTGTCTTCAATGTCAA
AAAACACATACGCAGGAATCGATTCATCGGTACTTAAACGCAGCGCAGACGGCGCTGAACATACCAGTGTTTAAAGCCATCGTCGAGACTATCGTTGGCG
AGATGTTCTTCAAGCCTGAGCTGGATGAGGATGATGAGGAGATGGAGCCGATCACTATGACGAATGCCTTAAAGTTGTTTGAGTAGCAGCCGGACGGGTC
ATACGTGGCAAAGATCAACAATCCCATTTTTTCGATCTGGTGCTTAAGCAGTCGTCTGTCGGCCTGTCCTTAGGACAGACTTCGGCAGTAATTGCCTACC
ATAAGTACGCATTTGGCAACGCGCGACTCGCTGGTATCAAAGATCATGAGGTTGGCAAGATGGTCCGAGGAACGTTGGCGCAAATTTGCAGGTTCTGTCG
GATGTGAGGTGTAGTAGTCGGGAGAAATCCTGACCAATCGCATCTTTTCACATCATGGGTACATGCGGGACCGGTCACGCCGGCCTTGGGACTAACCGCT
AGAAATCTCCAACGGTACGGTGGAAAGTTGACAAGTCATCGGTAGCGGTCATAGGCGGTGACCAGCGGTCATGGTCACGGTTGACGACCAGCGGTTATGG
TCAATATGGATGACCAGCGGTCATGGTCACTATGGACGACCTACGGTCAGCTGGCAGTTGAGGTGGGTCACTTCAAGCACAGGGAATGGGTGGCGGGGAG
CGAACGACGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGAGCGAACGACGTAACAGAAACTGAGATACAGAGAAGTATAAGC
GTAGTTCTAGCTCCTAATAGGTTGATAACGAGCAGTATTGATTTTCGTACAAGAGACACGCGTCAGCATCCCTCCGGGCTGGAATTCTAGTGGCCACCCG
ACGTTCAAGGTTTACTGCTCACGTGTTTGTTCAAGTTTTGCTCCTATGATTTCATGGATAGGGACAAGGATACTCATTCAAGTTAGCCCGCTTGATCGGA
CGCGGCAAGCATATAAAGGCAAGGTCTTCAGATGGCTCAAGTGGTCAGAAGAACAAGGGGATCAAGTATCCACATTTGGGCAAGGCGACCTCAAGGAAGG
TCAGGGCGAATATGGGAGAGCGCCACAAGTAAATTTTGGTCGTGTAAAGAATCCCCACGCGACCACACCCCACCTATCCCCAACTCGGTCAAGACAGACA
TCGACCTCAAGCCACCTAGAAGAGTGCAACCCGCCCGCCGAAGGGTACACAAGGTGAGAAGGAACAAGACAAGACACACGGTCCGGAGTCCCCCCTCCGT
TAGTCGGTCGTCCAGGCGCAAGTGAAGAGTTGGGATCGCTTCGAAAAATGAGCGAATCCCACTCAATCACAATGGTGCGCGTGCCCGGATTCGTACCAAG
GATTTTATCGTGAATCCCAGAGCAAAGATGTCAAGGTCAAGGTTGAACGAAGGATGGAAGTGTCGGCGAAGAAGGAATTATCGCAGACACGTGATCATCA
AAAAATTTCGGTTCGTCAGAGTTTTGGGAGAGGATAGGGTGAACCAAAAGTTAAAGAGGAAGATCACTCAAGTGATCTTGAAGAAAAACCAATACTCCCT
CCTGAGGTTCCTTCGGGGACCACCGCGGGTCGTACTGCAAAATACGACCTGCTAGATGGAACACGTCCAGCCAAAGCAGGACATGTTTCGTCTAAAAACA
AAACTACATACAAAGACAAAAGATCGAAGGCTACGGCTCAAAAGCTAAGTGCACCTGACTCCGAGGGTGACGATCAGGAAACGAGCCGGGCAGCAGAGGT
CAAGATGGAAGGTTGGAAGATGGATCAGCTACAACGTCATTTGCACTGGACCCAGCTTCAAATTTTGCGATCGACAGATCCAGTACTCACGATATCGGAA
CCGGAGATGATCGGACCAATCCGAGCACATACAATGGCACCACGAGCTGCCACAAGCAAAATGGAAGTGGTACAACGTCTCACTTAAAATGCTACAAGGC
GCAGGATTTGTACCGACGGCGTTCGATGCGCAGGTATTACTTGACTGCGACCTGGATTAGGTGATCACGGCCAGCCGATCACTGTTTAAAGCGCTGGTCC
CCATGACCGGTAATTATGACTCCGCTGATCGCGAACTCACTACCACCGTCAAAGTCAAAGAGGAAGAACATTCCACGGCTGTGTCTTCAAATGACGCCTC
TGCGGAGTCGGATGCAGAGGAAAGCGATGACATGAAGATCAAACGAATGTCGTTGGGACCTCCCGGAGCAGAACTTTTGCGTGACCACCACGATCATACG
GCACCAACCACCAGGGAGATGGGTTCAACCACTACGCAAGTCCCTGCTACGGATGAGTCCGACCAGATGCAAGTCTACGTTGCAAAAGCCATGGAAAAGT
TCTTACAGGAACAACACCTTCGACCGCTTCGTGCTGACCGGTCGCCTCACCTCCAATCACAATGTGTTCTGGGCGTGTATGCCGGACACCGACATGGAAT
CAGCTGATTAGTATGAAAGCTGCGGCAACGCATTCGACCCTGAAATCTCGATATCGACGGCCTCCGACGACCCTACTTGGCTACCACAGAGGCCACAACA
GGAGAAGGCTTTGATGCGCAGCGGATTCGCATGTCTGCGATTGCCGAGTTTAAGGAATTTTCAGGCCGCGATCACGACGATGACCGCGCTCGAGGATGGG
TACGCAAAGTCAGGTCAGCTTTCTTGCTTGACCGAAACCCGGACTCGGAGAAGTGTCTGGTTTCTGTTGATCTGCCAACAGGCCCAGAACGAAACTGGTA
TTCCCAATTGAGTCGATCAACTCGCAATAAGTGGAAAGATCTTCTCAAGAGCTTCCTCTTACAATGCTGCGGACCCGGCGTCTCCGCTGGGCGCCAGGAT
TATCATGCCTGCAAGCGTGCCGATGAGACTCCGTTAGAATATCTCTACCGATTGAACGTTGCTGGGATGCGAGCGAAGATTCACGTGAAAGATGGGAATA
TCGCTGATCGCTGTGACCATGTGGAACACTATATCGAAACACTGGACGAGCAAGACCTCGCGAATCAATTAACGCTGCTGCGATTAGATGACGTGGATAC
ACTGGAAGCAACGCTACACACATACGAACGTATGCAGAAACGCAAAAGCAACCTTAGACCAGTTCAAGCAAGTTCCGCTCACGGTCAGCATCACCATACA
C