Description :
From Genome Similarity Track
Location :
Scaffold_898:12754- 17466
Transcript NameFunction/comments
Phyta_totarag11247hypothetical protein PHYSODRAFT_302895
Phyta_totarag11248hypothetical protein PHYSODRAFT_511418
Phyta_totarag11249conserved hypothetical protein

Sequence
4712 bases(100 bases per row)
TAGTGTCACTCAGAAACAATGTGCTGCGAAGTGCCAGCTCCCGTTGGAAGCTCGAGCCTCGAGTGCCAGTGGTGACTTCACCGCTTGATGCGATGCGACC
GAAGAACCCAGCGATGTCCAGCAGGATcactgggggggggggggttctAGTCGACGCAAGTGCCACAATACCCAGCTCAAAAAGCTCGTTTTACCAGTAC
CAGAGGATCCGGTAATCACTACCCGATGGTGCGGCACCTCGGGGTGGTCCACGAATGCCATGGCCAAGAGCAGCATAACTTGATACGCTGGACGCACATA
CAAACGTGACGGAGTCGTCGCTAGCGATCTGTCGTTGAGCCATTGCACACCCTGGGGGAGTTCCAGTACTGCTGGGATAGCTGAGCCAGGGAGGATTCCG
CCGTAGCTGAACGTCCGATCATTCTGGGGCCCCGGCGACAACGGGATCAGTTCGATTGTTGCTATCACATCCACGAATTGCTGGACAACCTCCCTGTCCA
CCATGATTGATTTGTGCTGGTTTGTTGGAAAGATGGAGTTGCTTTGTGATGGAGCCCGAGAAATCGAAAGTGAGGAGGGTGAGACCAGCCAACCAAAGAA
AAACTACCACTGGTAGTCTACCAGCAGAGGCTGAAATCCGGTGCCGATAGACTATCGGCGATAGCAGATACCATCGCGTCTGTTAGTGTCGTGCGGTCCC
TCCGCTATGACTCGCGTTGCTTGCATCGGTTGCGTTGGCGCCGAAAGGCATCTCTCGACACCGAATACAACTGTAGAAAGCTCGGTCGTCACTATCACTA
TTCCAAAGTGTGCACGTGCTGCGTGGTGCCATGCTGCATGGCCCAAgcaagcccccccccccccccccccccaagcACGTCTTATTTGCGCAGCATTTCT
GTTTTGCAACGTGAAGTTTCCTTCGAGGAGTTGGGCACAACGTAGTGAAAAATGGGCCTTGGCCACCTAGTTTCGCCCATACGGAACAAGCAACGCAAGA
CCAGCCCTGACGACAGATATCTGACTGCCGAGAAGCGCTCCAACGTGTACGGGGGTCGCTTCTTGGCTTGCGCTGATCTTTGAGTCCGTGGCACcgctgc
agtggcagctAGGGGACACCGATGTGGGATGTGAGAGCAGCGTTCTCCTGATAGTACACCTACAAACCATTAGGTGGATATATATTGGCGCTGTAAACTT
CATTGTTTCATGACGACCAAGCATGTTGCAGCCGCATGGATGCAGCGCCACTCCATGAGAAAGATGATGCTAAGTTAAGAGGACAAGACGGCCCAGCCTT
CCGTCGGAGAAGTATCTCCACGTCACTGCGTCGAACGAGTGTGTAGCATTGACCCACTCCATCATCAACGATAGCAGTTGCGGATGActgcctccaccac
cactcgCCATCTATTGTTTGatccaagttgaagctgcattCATACTTCTctctcattggtcaaaacaACACCCTCCAAAACATTATATTACCGGTTTTTA
CGGTATGCATAATCGTAGGCTGATGTACACCCATGCTAAAGAATACAGTTGAACCCTTGGCTGTGGCGAACACTGCAATTGCCTTCTGCCTGCGTGACAT
TCGTCGCTATGAGTCGAGGACGGGGCCACGGCCGCGTGCGCTTCGGCGGAAGCAGAGACTCGATGCTAGCAGATATCATGGACGAGACGCGTGAGGACTT
GGGGCTCTCGCACACgcagatggagctgctgcacgtacgTGTCAATctctccctctctctctctcaatCCCCATCTATTGCCGTGCAATAACTGACAATG
CTGTTGCTACaggcagaagctggtgcatCGCTGTATCCACCAATGGAACTGCCGCAACCCGAGGCGCTAGCCGACCGCGAGGCGTATTTGATCCAGAGGC
AGCGCATCCTGTCGCACAAGCTCGAGAGTTTGTACCACCCGTGGGAGGCCGACCCGGCAGGCCCAGATGCCGGACGCAATACGTCGGACCCAGCAGCTTT
TGTGCACGTGACAGTGCCGGAGACGCAGAAAGCCAATGAGGTTTACGTGCCGGAAGAGCTGCGGGCCAGTTCGCTCAGTGGCCTGCGCACACCGGCGGCT
GCAGGCTCTACGAACCGCGGCATCATGCAGCCGCGTGCGTTTGAAACAGTGTTCAAATCTTTGGAAGCTCAGGAAAAAAAGATTGCAGCGGATAAGGCCA
AGGCGGCCGAGCAGGAGGCAGATGACGGCATCATGGATGACGCTGAAGAGGACTTGGGCGATGACATGAACGACTACACTTTCGACTACTACGACAGTGA
CGCTGTGAgcaacgaaggcgacgaagaggtTTTCTTCTAGAACAATTACTCGCTCGCAGCACAGGTGGCGTAGGGTCCAGTCGAAGACGCATGCCGCACG
CGCACACGGCTGGGGAATGGAGTGCCTCGAGCTTCTTTATTTATTTGCCCACCCCATCGCAAAAGCGTGCTTGCTCACTTCACTCGCTGCCTGTGCACCA
AATAGACATCTTTCAATTTACTACTATCCATAGTACACATTTGTTCAAGTGCACACGACAAACGAAAGTTGTTTTCTGCATGGAGAAGTGAGACAAAGAG
TTAAACCAATTTGGCACTACAGCAACTGGAATGAAATTGCAAACACGCACAACGATGTCAAAGCAGTCGATGCTGGTCGACACTGCGAATTATCAGATGG
ATGAAGTTGTAGCTGATGGATCTTACTCGTGCTCTCCAGACAACAGCGACGCGCTGAGCGGCGCCAGTCGGTTCTCATCCTGTGCTTCATCTGTGACCGT
AGTCGTTTCCGTATCAGCCGCTGTCCCATCGGCGTTAAGCTCCGCGCTCTTCTGCGCCAGGTTGGAGAGAGAATAGTTGTACATGACCGAATAGTTTGCA
GGCGCAATAGGGAGCGGCTTTACCCGACGAATAATCTCGccaggacgaggacgcgTGCGTGGCCGGCCCCGAGGCTTCCCTGTTCCTcgttgtttcttct
tcgccatcttggcCGGGCgctcggcatcttcatcttcctccttcaccgTCTGCTCATCACTAGCAGAGTGGTCCttgacaacagcaccaggATTCGACAT
GCCAGGCAGCATGCCCGGGAAGcccggcagcagcggtaTGGGCAGTCCGTATCCCCACATGGGGAACTGCTGCTTAAGTGTCTTTTCCGCTTCCGCCTTG
GCTCGCGCAGCCACGTCCTTTTTGGGTGGCCTGCcgcgcttgcgcttgggcACTTCGTCAATGTTCAACGGAGCAGAGTTCGCCCCTGTCAGCATTCCAA
AGCCGTCGGTGCCCACAAAAGGCGGCGTGAGGCCCAACGACTCGACGGTTGCCGGCTGATAAGATGGCGACGCGTCGCCGTCGTTCGCCGAAGTAGAcac
cgcagctgcagactcggccgcagccgcagcagcctcgtcaGACGTGGTTTCAGCCTCGGCAGACGTCGCTACTGCCTCGTCGGATGCAGTCGCGGAGGCA
TCGGTGGTCGTTGCTGCGCCCGCGGAGGCCGCTGTCagagcctgctgctgcagcggcatCATGAGAGGGAACATGGGCATCATGaagagcgcgagctgct
gctgctgcagggccGCGAGCTCGCTGGGGCTCATGTTCTGGCTCaagctctggagctgctgctgctgcagttggagcagctgcaactgttgctgctggag
ctgctgctggaggagcgcctgctgctgctgctgcgccaggTCGCCGCCCTTAGGCGTGGTGTCCGCCGCCGACTTGCCGTCCTCCGACATGGCGCTGGAA
ACTTTCCGGTGTAGCTGCTCGAAGTGAAGCTCACTGAGGAGGGGGATTTCTTCCTGTCGTTGGGCGCCGTGCGGATTTAAATCCAATAATGAGTGGAGAA
GCGCGGCGAGCAGGCCCCATTCGACAAAATACGGAAAAACCTCAATCAAACCGGTTTTATACAAAGGTTTTTCACTTATTTTAGGCTCTAGAAGATAAGT
ACGGCACAGGATTGGCCGAAACAACTATTAGTGACTAATTTTGATTGACGGAATTTGAACTGGCTTACATGGAGCCCAATTAAGCGGAGATTGGGTCGTG
CTATACTAGTATTTTGGTGATCGCGCTCACGCATTACTTACCGGTACTAATACACTACTAGGACAATTAGGACAATTAGGACAATTAGGACAATTAGGAC
AATTAGGACAATTAGGACAGCTAGACCTACCTGACGTAAGGAGTCTGTTGCGTTTAGCCCTGTGTCAGTATTCAACGCGAGTTCAGCCAGCGAAGAAGTG
TTCTGGGGGCTGTATCCAGTCTATTTAGGACATGTCCGTCCTAATTTATTGGTATTTTTAGGAcgtactacgtagtactaaGTGCAAAAATTACGCCCTT
GAGGATAGCCTTTTGGGAATTTCAGGATCGTTTTAGTAACCTACCTGTCTTCCTACGCTTCGCCGGCTGCAGCTACCTAAAAACACGGGCGTGAACATGT
CTTGTGGGTGACGACTCACAACAAGGGCTCTCGTAGTGAGAGACGCAATAATAAAGTAAGTGTGAAGACGCAACATCAAAGTGAAACCAGCAAGCTCGAA
ATACCAACTTCCACAGCTGTATCCGACCCGATCGACTCCAGTCTGTTCAAACTGCAACACAATGAGAGAATATGCTGGAGGCATTAGTGGCAAAGGCGAT
CGATGCGACGTG