Description :
From Genome Similarity Track
Location :
Scaffold_29:127535- 134843
Transcript NameFunction/comments
Sapdi_VS20SDRG_09113hypothetical protein
Sapdi_VS20SDRG_09114hypothetical protein
Sapdi_VS20SDRG_09115hypothetical protein
Sapdi_VS20SDRG_09116hypothetical protein

Sequence
7308 bases(100 bases per row)
CATGATCGCCTCGTCATGCGCAAAGAGCGACTTGTGGCAGTCACCAAAGTCGAGGCCCCAGAGCTTGACGTTCTTGTCGGCCGACGCGGTCACGAGCAGC
GTGTCGTCGGACGAGATATCCATGGCCATCACCGGCAGCTTGTGACCATACAGCGAGAGGAAAAACTTGAGCGAGTCGTCGAAGAACACCTTGACCGTGC
AGTCGAGGAGCGCGACGGCCACGAGCAGCTTGCGCGGGTCGCTCGAGTGGCTAAACTTGACGCAGAGCACGTCGTCCGACATTTTGAGCATACGGACGTG
CGCCAACCCGAGCTTGAGGCTCCCGCCAGCCGCTTGCGCCGCCATTTCAAACTCCCAAAAGTTGACCATGTGGTCGGCGCCGCCGGTCGCGAGGCCCTTC
CCGTCCGGACGCACGTCGATCGACCAGATGGCGCCGGCATGCGCATCTGCCTTTTTCCAAATGCACTCGCCAGACGCGAGCTCAAAGAGGAGGAGCTCGC
CGGCCTTGGTGCCGACGACGACGTGGAGGTTGCCGGGCGCAAAGACGGCCGAGAGTGCGAGCGAGAAGTCCGTGAGCGTTCGGACGCACTGCATCGAGCG
GGCGTTCCAGACCTTGACGGACGCGGACGAGACACTGAGCACGAGCTGGTCGTCGGACGAGATGCACACTTGACGGACGTCGGACCGGTGGCCGGGCAGC
GTCACGGCGTGCACCTTGGCGAAGCGCGCGTCCATCGACTCGGCGGACGGCGTCAGTGCATACGTCTCGATCGCGTTGTTGTGGAGCGAGACGAGCACGG
ACGTCGTGCCGTCCTTGGCAACGTCGGGCGAGAAGGCGAACGACCGGACCTTGGCACTGCACCGGATGATGCAGAGGAGCTCGACTTCGTTCGCGATCGG
GTTGGCGTCATCCTCGTCCTTGTCGTCGTCGTCCTCCGCGTCCTTGTCGGCGTCGACGGCCGGGATCGAGAGGCCCGACTTGCCGTCGACCGCTTCCTTC
TTGCGGGCCTTTTCACGCGCACGCTTGAGGCGACGCTGCGCCTTCTTCTTTTGCTCGTCGGCCGACCGGAGACGGAAGATCTCGATGGTCTTGCCCGCGC
CCTGGCAGCCGAGCAGCGTGCCGTGGCTGTTGTACGCAACGTGCATGGCGCGGTCATGCGTCGAACGCTGGATCGTGCCGAGCAGCGAGAGGCGGTTGTC
GCCGACGTTGTCGCCTTCGTTGACGCCGTACACGCGGAGCTTGTTGTCCGACGCACCCGTGAGGATGCGACGCGTGCCCTTTTGCATGTCGAGCGACCAA
ACTTCGTTGCGGTGGTCGACGCATGTCTGGACGCAGTGCTGTGTATCGAGGTCCCACACCTTGAGGAGCGAGTCTTTCGAGGTCGAGAGCAGCGAGCGCT
GGTTCTCGACAAAGCCCACGGATGTAACCGCGTCCTTGTGGCCGCGCAGGCGGTACAAGCCCGACTGACTCACGACGTCCCACACGATGATGTCCGTGTC
GCGCGAGCCCGACGCGAGAAGCGCGCCGCCCTCGCCAAAGGCCAAGCACTCGATCGCGTTCTTGTGGCCATCGAGCGTCACCTCGACATTGCCGTTGCTG
AGCTTGAAGATGCGAATGATGCCGGTCGAGTAGCCGACAGCGACAAAGGCGCCGTCGAGGCTCAGGCGCAGCGCGGTCACTTGGCCGGCCGTGTCGTTCT
CCGTGTCGGCCTTGAGCACGCGCACCTGCGTGCCCGTGCGGATGTTCCACACAATGACGTTCTTGAGCGCGCCGCAGATGGCGAGCTGGCCCGTGAGGTC
GTAGACGACCGGCGCGCCCGGGCTAGCGATGACGCCAAAGGCGGCTTCCGGCGCGTACTTGAGGTAGCTCTTCATATCGCGTCGCTTCGCAAGTTCACAC
TGCAAGCACTGGCGAGGCCATTGGATGGAAATGATTGGTCCGTACAGAGATCCTGTGGAAATGCATACGCCGTATTGCTACGGTTTTATCCGGAAGTGAG
CCGCACAAGAAGCTGCTGCTGATGGGTCCAGCAGGTTGGCGTCGGCCTGCGTCCCTGCGACGTGTTGCCGGCGATTGAAGGCAGCCATGCAGCCAGGCGA
ATGACCCTGTCGTCACCGTATCGCCAGGCGCAAGCTGGCGATCGGTGCTTGTTTTTACTAGTCCGCCATGGCGCGTCATGGGTCATCGAAGCGCTAGGAA
AACATTGCGTCGTTCGATGCATGTCTAGGCACCGGCTCCACGCAGTATCATGTAGGTGCATGCGCATGATGTGGCCGCGTTCGATGCGACGATGCCCTCC
CGCGTGGGAGCGGGCGCGGCCGTAGCACCGGTCGCGTCCACGGCGTCTTTGCTCCTCGAGTCCGGCGCGCCTCCCGCGCCAAAGATGCGGCAACCGCAGA
GAAGAGCAAGTACTAATACAACGATGTGAATAAATAAGCTTCAACCTACGCTATAAAGGACCGACACTAGTTGAGCATGGCCTCCACCGAGAGACGCCGG
CGCTTGTTGTCGATGACATGGATATCGCGGCGCGACGCCACCTTGGGCTCGACAATGTCCCGCGAAGACGACGACGATGACGACGACGCGCGGGGACGCA
TGGGCAGCTGGCTCTGGTACTGGAGCTGGTAATGCATCTGGAGGTACAATTGACGCTGGCGCTGCACCTCGAGCTGCATCATGTGCTGGCGCATCAACTG
AGCTTCGTACTGCTGCTGACGCATCTGCTGAATGTACTCTTGCTCGCTCTCGTGGCGCTCGGTGCGCGCTTGGTTGGTCTCGATGCAGAAGACGGCAATC
TCGTCAATCGAGAAGCCAAGGTCGCGCAGGCGCTCAATGCGCTTCATGGGCGCCAGGTACAGCTCTTCGTGCGAGCGAGGCGACCCTAGGCGGTCGGCGA
CAGACGTCGTGTGCGTCGAAATGGGCTTGCCCATGAGGCCAAGGCCGGGCCCACCCGTGCTCGGGACGCTGCACGGGTTGTGGCCGAGCTCAAACTCATG
CACCGTTGTCGTCGCCCACGTGACCGTCTTCTTTGTGGTCGTCGTCGGAACCATCGTCGTGCTCATGGTCGCTACTGTCGTCGGTTGGGAGGAAGCTCAA
ATGCGAGGCTGGACGGACCACGCAAAGCATCCAGACAACCAAGATCTGGTTGCATTACGCACGCCAATTACCCCGCGCGTTCCGCTCGTGTTGATGGCAA
TTCGGAAAGCGTTACGTCGGCTGTGACATACGTCGTTTTATACCAACGTTTTATCTTGTCTTGGGCTTTGTATCCAAATGCTATCAAAACAATAGTATAT
CCTGTGGCAGTCTATACCCTGTCACAATGCATATTCAAATATTTAGCATACATTTCTTTACCTACATACAAATACAACCAAGGCGTGAATGCAACCTCTT
GAAAATGCATAACACGGCCCGCGTGCGTTTGGGTACCAAGGCCAGTGGCCGTCGTGACGAGCGTGGCGCCGCATGCAATGGTTGTGACTTGCGTGTTCGA
CGCAGCAAATCCTTTGCGGTGGCAGCTGCGTTATCGACCGAGTAACTCGTGAGTAGCGAGCGTCGGCAGCCGCCGACAGTCCGATCGCATCGATGACACG
GCGCTGGTCCCTTTTCACAAGCCGTTCTTGAAGCTGCCGCAGCTGCGAGCGGAAGCGACAGGCGATCTTCCTCCTCCTCCTCGGTGGATTGAACTTTGCA
TTTCGGTGAGTCGAAAAGTGACACATCTGATATCCACATGTGTAGCTCGCTTACGTACGAGCTCGGAGACGCCGTTCACTTGTCAACGCCAGCGCGATGA
GCAGGCGGCTACTTGCAGCTTGTCGCCAGCACCACGCAGCCATCCGCGGCGTGTTGTCAGCGGCGCGCAGCCGCCGAACTGCGTTCAGGTTCGAAGCACT
GGCTCGGCGTCCGGATAATCGGCGTCCGGATACCGCATCCTTGAGCCAAACAGCAAAGTGGCAGGATGGCGACTTTGACGAGGTGGGCCGACGCGCCCGG
GACGCTCGTCGCCGTCGGCGCCTCCGTGGCCCTCGGCCTCTTCTACGCGGCGTTCCAGCTCCACTTGCTCCCGGTGCCGCTCGCGCGCATTGCTGGACGG
CTCTACTTTTACCCGACGCTGCCCTTGACGTACCTTGCGCGGCGCAAGAACTATTTCACGCTCGTCGACTCGCACGTCTTCCTGGGCGCTGTGCCCATTG
CCGCGCTCGGCCATGTCGAGCAAATGCACGCGCGGGGCGTCCGCGCGGTCGTCAACCTCTGCGACGAGTACGCTGGGCCGGTTGTGGCGTACCGCAAGCG
GGGCATCCAGCAGCTCTGGCTCCCGACCGTCGTACGCTCTCTACATGTATTACGTTACAGCATTAGCTTCACAGGGGATGGTAGGACCACACGGAGCCGT
CGCTCGAAGACATTCGCAAGGCGATCGACTTTATCTCGTTCCACAAGGAGCGCGGGTCGCGCGTCTACATCCACTGCAAGGCGGGCGCCGGGCGCAGCGC
CACCATCGCGTTCTGCTGGCTCCTCCACGCCAAAGAGACGTGGAACCTCCCCGAGACGCAGCTCTATCTGAGCGTACGGCGCAAGGTACGCAAGACGCTT
GGCCAGCAGCCGAATGCCATCGCGTACTTTGCGTCCCTTCGCCCGCCGGTCACATCGCCCGTCTTTCCCGCGACGCTGTCCAAGGCTGGACAATAAAGCG
GTGGCAACCTACATAGTGCCTTGCACCCTCTTCTAAGGAGATGGAGGGTTGTGGTTCTAACGTTATAAAACAGAGCTAGGACTCGTAGTAGACACCGTAG
CCGCCGAAGCGCAGTTCGCGGTCGTACTTGGCCTTCTCGTGCGGGTCGGAGAGAATGGCATATGCGGCCGTCATGTCCTTGAACAGCACCGCGTCAGCCT
CCGACTTGGCCTTATCTAGAAGACCACCCACATAGTCCGACGTCCACTGTCTGCCACCGACGCAGTACCTGGGTGATGTTTCAGTGCGAGCTTTCGGTAC
GAGATCTTGATCTCGGACGCTGTCGCAGTGATAGGCACGTGCAGCACCTCGTAGTGGGACTTGACGCGCACGGGAGCTTGTGGCTTGTGCGTCTGGTGCC
GGTTCCCGCCATTTTGCGACGCCCGACCACCCTTGTTGGACGATGATTTGCTGCCGTAAAAGTAGTCGTTGTACGGGTCGTAGCCGCCACGACGCTCCTG
CTGCTTCTGGCGCTCCTTGCGCTGCTTGGCCCGCGCTCGCTCCTGCTGCTCGTACTCGTGCGCGGCGGCCTTGGCTTGCGCAGCGCGCAATTCCGCTGCG
AGGGCATCGTGCTCGTCCTGCGTCGCGCTTGCCTCGGTCGCGTCCATGTAGGCGCGGAGGTCGGCGATGCCGTCCTTGAACTTGAGCAAATTTAGCAAAC
AGCGCGCTTTTCGCAGCAGCGCACGGTAGTAATTTGGCTTGCGCGAGAGCGCATCTTTGCAGTCGGCAATCGCCGGCGTCCACTTGGCCAGCCCCATGAG
CGCCGCCGCGCGGTTGCAGAAAAGGACCGCGTTGTACATGTCGTGGTCGGCGTCGAGCCCGAGCCCGGCCGAGTAAAAGTTGATGGCGCGCACGAAGTTG
CCGCAGCTGAACGCATCGTTGCCCAGGGCCTAGTCCGCCATCTTGTTGCATGCAACGTTCACTCGGCGTACCTTGGCCTGCTTCATGTCGAGCCAGAGCT
GCTTGAGCTTGAGCACATACTTGCTCGTGGGCGCCGCCTCTTCCAGCTCATGGAGCACCGTCTCGGCGTTCTCGACCTAGTTGGCCATTTTACTAGCAGC
AAATGTGGACGTCGACTACCTCGTCCAGGTAGTGCAAACTACGTGCGTACTGAAGCCCAAAGTCGATGCCGAGGGCCACGATCGCAGTGTGCAACTGCAG
CTGCTGCATGGCATACGCCTTTGCATCCGAAAAGCGCCTAGTACCGTCCCCCGTAGAACACGATATCACGGCAGAGGAGAACGGTGCGACGTACTTGAGG
GCCACGAGCGCATTCATCTTCTGGAGCACGAGGTCGCGGCTGTACGGGGCGTACGTAAGGGCGCTTGTCGTTTGCTGCAGCGCTTTCGCCGTCTCGAGCA
CATCAAAGCACCACTTGGCTTCGTGCAGCGCCGAGACGAACGCCTCGACGTCGCGAATCGCATGGTCGACCTGCGGCTTGTACACGGTCTGCTCTTCGGG
ACTGGCGTGCGCTAGCAGCTTGTAGACGCCGAGAAAGGTGTTGCGCGCCCGGTCGTGGTCGCCGAGGAGCAAGTGGCACCGCCCGTAGCGCAGATGCGCC
TACAAGCATGTGCCAAATCGTACAAGCGCCTTGATAGTCGATGTACCCGAAGGTACGTGGGGTTGAGCGCCATCGCAGCCTCGGCGTCTTGAAGCGCCTC
GCGGATCTTGTGCAGCATCATGAAGGCGGCGGCGCGGTTGGCGAGCATCTTGGCGTGTTCTGCCATGACGCGATCGAACGCTGGCTCATCCGCGAGGCTC
TCCACGCCGCGGGTGTAGAACTGGGCGGCCGCCAGGTAGTCCTTGCGTTGGTACGCGGCGCTGCCGTCGCGCTTGCACTGAATCCATGCCGGCTCGACCG
GCGGCGGCGTCGGTGGAGGCTTTGGAACCGGGGCTGGAGACGGCATCGGGGCTCGTTTTGGACGGGGCACGCGGCGCTTGGCGCCTTTTGTCGATGGTTT
GGGCGTAGTACCAAAGGCAAAACCAGGGGCGGGCGGCGGTGTCTCCCACGGCGACTCGAAGAGCTCGCGGTTGCAGTTTCGGAGAGGGCAAATGTTGCCC
ACTTCAGCGCACGGGGCGCAGAGATGCAAGTCCACAAACACCGTTCGAAGCGCCTGCTGGCAGCACGAGCAATGCACTAGGAATGGTGCGTGCGGCTGCG
TGCGCGCGTCGAGTCGGTGGACCTCGCACAGTCGAATGTACTCGCAGTCGGCGCCGTTCGGTGGCGGCTCGTGGACGTTGAACGCCTGGAATTGATGCAT
GAATGCATCGTCGATCGGTCTACGCAGGTAAGTTTGCGAGGAGCTCCGCAGTAGAAGAATGGGCGTACGCCGAAGTGGTTGGAGGTGTGGTCGCGGGTTG
CGGTGGCGCGGAATCAAAGCCATGTCGGCCCGGTCCAGGCGACTGGATCGGACTCGGGGCCGGTTGCGACGCTGGAGGTACCGCAAAGGTGTCTGCCTGA
GGCATCGCGAAAGGATCGATCGTGGGACTCGGGGACGATGCAGATCGGACAAACTTTGTCCGGAAGGCAGCATTCAATGCCGCCTGCTTCGTCTTCTTCT
TCGAGCTG