Description :
From Genome Similarity Track
Location :
Scaffold_123:12751- 13900
Transcript NameFunction/comments
Pytul_var.sporangiiferumsnap-pug3_contig_123-abinit-gene-0.81DEAD/DEAH box RNA helicase

Sequence
1149 bases(100 bases per row)
CTTCGACAAGTACGATGACATTCCAGTCGAGACCAGTGGTGAGAACGTGCCAGACCCAGTGACTGAGTTCAAGGTGGAAGAGTTGGGCCCTGAAGTCGTG
CGCAACTTGGATCTTTGCAAGTACGACAAGCCGACCCCAGTGCAAAAGTACTCGATCCCGATTGGTCTTGCTGGTCGTGATATGATGGCGTGTGCGCAAA
CTGGTTCTGGTAAGACTGGTGGTTTCTTGTTCCCAACGCTTGCGGCGATGCTCCGTGTTGGTGCGCAGACCCCACCTGAAGCCAACATGGGCCGTACTCG
CAAGATTTTCCCATCGGCTCTCGTGTTGGCACCAACCCGTGAACTTGCCTCGCAGATTTACGATGAAGCCAAGAAATTCTGCTACTGCACGGGTATCGCC
CCTGTCTGTGTGTACGGTGGTGCTGAAGTTGGTAAGCAACTTCGTGAACTCGAGCGTGGTTGTGATCTCTTGGTCGCTACCCCTGGTCGTCTTGTCGATT
TGATGGAACGTGGCCGCATCTCGCTTGCTGGTATCCGATTCTTGATTCTTGATGAAGCTGATCGCATGCTTGATATGGGTTTCGAGCCCCAGATTCGCCG
TATTGTCGAGCAAGAAGACATGCCACGTGAACGTCAGACGTTCATGTTTAGTGCCACGTTCCCTCGTGAGATCCAGCGACTTGCTTCGGATTTCTTGCAA
GACTACATTTTCTTGACAGTTGGCCGTGTCGGTTCGGCGTCAAAGGATGTCAAGCAGAGCGTCGAGTACATTGAGCAGTACGACAAGGAAGACTACTTGA
TTCGTTTCTTGAACCAAGTGCAAGATGGTCTGATCTTGGTGTTCGTCGAAACCAAGCGTAACGCCGATTTCTTGGAAGACTTGCTCTGCCGTGAAGGCTT
CCCAGCAACGTCGATCCACGGTGACCGCACGCAGCGCGAACGTGAACAGGCGTTGGCGAGCTTNNNNNNNNNNNNNNNNNNNNNCCGATCGGGCCGTACC
CCAGTGCTTGTGGCGACGGATGTGGCTGCCCGTGGTCTTGATATCAACGGTGTGACTCAGGTTATCAACTACGACTTGCCAAGCAACATTGACGACTACG
TGCATCGTATTGGTCGTACCGGTCGTGTGGGTAACGTCGGTTTTGCGCT