Description :
From Genome Similarity Track
Location :
Scaffold_11:1275016- 1276081
Transcript NameFunction/comments
Phypa_INRA-310PPTG_07337transmembrane protein

Sequence
1065 bases(100 bases per row)
GGCGTGCAGCTCTTCGCACTCATGTGGCAGCTATCGCAGCCCTGGCCCTGGCCTGCTCGCTGGCTGGAGGCCACCCGTTGGGCCAACGCATTCTCTCTTG
ACTTCTTCAGTTTCCGAGCCACAGGCGCTGCCATGGGCTCCACGTCGCAGTCATTTTCACTATGGGGTGAGATGCCTCAATATTGGCTCTACGCTCTCGC
GTGGGCGCTCGTGCCGTGGACTGGAGTGTTGATGCTGCAAGTGTCCAAGCGAGTGTGGAACAAACAGGGACGCAGTGACTACTTGCTGCTCGGTGTGACG
TGGGAGAATGTGTTACTGCAGATACTACAGTTCCTGTATGTGCCTGTGGGGCTGACCGTGTTGCGATTGGTAAACTGCAATGCTGATGGCAAAGTGTCGG
TCGATCCTATGGGTATGACCTGTGGTAGCGTGGGGCATGTAATGGCAGTACTGGTTATTACATGTATCATGGGTGGGGGCTTTCTGGTTGGACTCCCGTG
GACATTACGCCGCCGTATTCGAGAGTCGATGGTTCATTCGAGCGTGGAGAAGCACGAACGCTTTATACAGGGAAAGGAGCTGGAGTTTATACTCGGCACG
TCGGATACATATCTGGAGCTGTACATGCCACAGTTTGCGTCTTTCCATAGATACTCAGCGGAGATGCCAGTGCAGATGTGCATGATCAAGTTGTTGCTGA
TGCTTGTCTTCTCAGTTTTGCGGTCGCCATGGCCTTCAATGGTGAATCAGGGGATGCAAGGGTCGATTTTCTTCTTTGTAGTTGTGGGTACGGCTGTGTA
TAGGACGTGGAGATTTCATTATCGCTGTGTGTCCACGTCTCACTTAGTCATTCTCGTCGACTGGATGCTGGTCGCCAACGGAGTATTTGGTAGGAATTTT
TTTCTGATGATAACTGTTTTGTGTTGTTGTCACTGATTTGAGACGATTTGGTAGTGTTGCTTTGTGCAAATGGTGTCCGCAGTGCACTTACAGTGTCAAC
ATCGGTGACGTCATCGTTGACTTTCCTGAATGCATGTTTCTTGGTTATGATCAGCTTGAAGGGGC