Description :
From Genome Similarity Track
Location :
Scaffold_510:1275- 3113
Transcript NameFunction/comments
Albla_Nc14135240conserved hypothetical protein

Sequence
1838 bases(100 bases per row)
TCCTTCTTCGATGATGCAAGTGTGCGTAGATGTGCGAACACCCCAAGAAAGTTGGCCAATTCGTTGCACTGATTGCCTCACTAGCAATAGCACGTCCATC
ACACCAATTCCAGAGCCCTTTCCTGATGCTACTGAACTGGAAGATGAGTCAGATGAGACAATAGTCCGCTCAACAACCGGAGTATCATCATCGGCAGTAT
CGGAACCGTGAGGGCTTGACGAATCTTCGGTGCTAAAATTCTTCTTTTGGATGAATTCTCCTTTCTTCCCTCCAACTGCCCATGACATGAGGTTAGCTGC
ACTCGAAAGTAGAGAAGTGGAGGAATCTTGCACAGTTGGATACTTGCCAGTGGTATTACGATGCGCTTTTTTGTGGTCGTCTTCACTTCTCAATTGCTTG
GCAGCTCGCCGTGTGTGATTTTTTTTCTGATACACTTCCATCGTCAACGTCTCATTCTTCCCGCTGCTCTCCTCATTCGTTTCGTCTGGCGGTGGTAGGG
CAAGAAGAGAGGTTCCATTCGAGGCGTTTGCATCACCATCACCCAACTCAAGTAAGGGATTTCCATCTAGCATTTCGAAGCGTGTTCCTGGAAAGTTTTC
TATGTATGCGGTTCCAAGTGTCGCGAATACGTGTCTACATATCGAGCTATTCTCTTTCACCCAGAGCCCTGTCGATTCACGGAATTGTTTGTACAGTTTT
TGTACATAAACAGGATCCGCATTCGCTTTGATTCGTTGTATTGGTTCCATACAAGCTCCAAAGTCGTGTGCGATATAGTTCTCTAGAGGTAATACCTTGC
TAAAACTCCATCGCCAGGCTTTTTCTTGATTTGGTTTCAGTTGATCCAGTTCACGTACACCAATCTGCGTCAACGAGCTGACAAGTTTGCTAATCTCGGC
CTGGACCCCCTCTAATGAAGTCATCAATCTCCGAACTTCCTGGCCACCTGGTCCATAAACCAGCAAATCTCCACCGGGTCCAGCGAGTTGACGTGCCTTC
CGACATGAGACCAGCAGATCCGCAAGCAGCTTGAGTAATCCGTGAATCCGAGTGAAGGTTTCATAAGCTGTAACGATCGAGTCGGATCGCAGCGCCACAA
CACCTGAATTACTCTGTGTCAGGTAATCCACGGCAGTCAGAGTGTTCGGTTTAGCTTGATCCAGTGCTGAAGATCGTCGCGAGTTTCTCGTCAATACAGC
CGGAATCACTGGTTGAGCTTGTTCGTCACAAAATACAGCTGTGCTATTCAGCTCTGCTTCTTCCTCGTCTGTGATTTGTAGAGGATGAATTCCGTCGCGC
TGGTACGTTGGTCCTTCGGGGAATAGCGTCCTATCAAACACAGTGAGATTGGCCAAAGCGATGCGAAAATACTGGCAGGATTGACGTACTTGAATGAATT
TGTCGTTAGCAGGACCTGTAGCATTTGACCCGCTTTCGTTTGCATTGCATCCTATCAAGCTGTGTTATCGAGCAGCACCTAAACAAATTAAAAAGTGTGT
ACCTTCATTCCCAAATGTTGTTGTATACGAAGGTTGCTGATGGTACAATCCGCGGGTGTATTGGGTGTATTCCTCAACACGTAGAATAGAAACTGTACAC
CATGCATCAATCCATCGATTCCTCTTGCTTCGAGTGTTTGTAATTGTTCTCGTGCAGATGAGTGTGCTCTTTCCGCCTCAATGGTTGGAAGAACTCGCGT
CTCAATCACATTCCGAACATCTTTAAGCGTGCCAATCAGCGAACGCTCGCCCGAGCCAGAATGAAACAAGCCTTGTTGCCCATGTTGTAGCCGTAGAATA
TAGGTGTGACGTCTCCTTACATCATTCAGAATGCTTTC