Description :
From Genome Similarity Track
Location :
Scaffold_1926:1275- 2299
Sequence
1024 bases(100 bases per row)
TAAGCGCTAACCAGGTGGGTAACTTAGGACCACACGGTCGCCCAGACCTTAACTGAAGAGGAAGGCGCTGAATGCGCTTCCTGTGTGGATAACACAGTAC
CACACACAGTCGCCCAGACTATAACTGAAGAGGAAGGCATGACCATGCTTCCTGTGTGGGTAACACAGTGCCGCACGAGGTCTCGAGTGCCTCTGATGTC
GTCATCGAGAAATCACGACGTGGGTTACAAAGTGCCACGTCACGTTAATCGCCGCAAGTCGGGTCTGAACCTTGTTCAGGCCGACGTCGCTTCAAGCGAC
TCGGCGTCCAGGGAAACGCGAATCCCCCTCCCCCAACCCCTCCGACTCCGTCCGTGGAACACCCATCCGATCCGTTGTGTGTGGCGCGTTCGCCCCATTC
CCGATGTCAAACTCAAAACCCAGATCCTCGTCCGCCGCTAAGATATCTTGAAGTGGTGGTGCCCAAGGGCATCACAGTGGGTAACATAGTCCACACTGCG
ATAACAGCTCCGCAAGCAGCGAAGCTGCTTAAGGAGACGACATTCGGTGCTCCGAGCGTGGGTAACATAGGTCCACGCAAGGTCACTAGACTATAACTGA
TAAGGAAGTCGCTGTATGCGCTTCCGGTGTGGGTAACATAGTTCCACACCCAAGGTGGGTAACATAGTTCCGCACACAGAGCCATTGGCTCGAGGCGCGA
GGCTGTCTTGGCCTCGCCAAACGTGAGCAACTCGCTCGACGTCAAGTCGCGCAGACTCAAACTGCTGACGCGAAGGCTGGGTGCCTTCGGGCGACACAGC
CGACGCGGTCGTCCATACCGACGCAGTGCACAGGGCGGAGAGCCGTCGCACCTGCCAGTGGCTATCAGAAGCCACGAGAGACTCAGTAGTCTCGAGGTTA
AGTGGGGGAGAGGCTCGGAAATACCTTTCCTCCCTGACTTTCCACGAGGCAGGTAGCCGTCGTGCTGTCAGTGGTTATCACAAGCCACGAGAGACTCAAT
GGTCTCAAGTGTAAGTGGGGGAGA