Description :
From Genome Similarity Track
Location :
Scaffold_2:127481- 135073
Transcript NameFunction/comments
Sapdi_VS20SDRG_00642hypothetical protein
Sapdi_VS20SDRG_00643hypothetical protein
Sapdi_VS20SDRG_00644hypothetical protein
Sapdi_VS20SDRG_00645hypothetical protein

Sequence
7592 bases(100 bases per row)
TTCGCGCGGCAGCTGCGCGTGGGCAATGCCCATCGACGCCTTGTACCACTGCCGCATGGCGTCGACAAAGCCAATCGCGGCGACGCTGCAAGCAAACGTC
TTGGCGGCCGCTTGGCACACAGCGTTGTACTCGGCCTCGACATGCGTGTCGAGGATCGCAAACGACGAGAGCGCGAGCAGCCGCGTCTCTTCGGCTTCCA
TATTGCCAAACGAGTAGCTGTTTGTGCTTTGGTGGCTCTGTGACAGTGGCAGCAGCGTCGGCGGCGCGGCCGAGTTGCGGTAGAATTGGACTTCGCCAAT
GCAGTCCATGCAGATGCGCACCGTGAGGATCGTCGCGTTCTTGATCGACGAGCTGCGCTGGCGCGAGAGGGACGGGCGCGGCAGGACGTCGCGGACGTGC
CGGTGCAAGGAGCACTGGCTGCACACAACCTCGCCGCACGCGCGGCAGTGGTGCTTGCGGACAAACGTGTTGAAGCGGCGGATGCAGATGACGCACTGCG
GCCGATCCTTGTCGGCGACCCACTCGTTCATGTGCTTGAGGTGGAACTCGAGCACATCGTCGGGAATCCGGCCGCGCTTGGACGACGACGATGCGAGCAG
CATGGCGCGAGAGAGAGACTGGCGACGGTGTGGTAGAGGCCCATCAACTGCCAGCTGCTGTATCAGTGTCCTGCGACACCTGCAGCAGCTTTGGTGCATG
TATTATTCAGCGACCAAGCAGGTCAGGGACGAGGGGCATCGTGTCATCATCTTCGTCGTATTTATAGCAGAAGAGAAGACCAACATGTAGTGTATTCCGA
GTCATTTGGCCCTCATGCGTGAATCGCAGGACGGTCTTCTTCGGCGACGAGCCAGACGCTGTCGTCCTCTTGGTCGAGGCGCTGCGCGAGCGCGAGGATC
GAGCCGGTCTCGAGAAGGTACGACACGAGGCGGTCGTTGGCGTCGACCATGTCGTCGAGGTGCCGCGTCGACGTCGTCTTGTGCTTGCCCGGGCGCAGCG
GCCGCACCTCGCGCTGCTGCTCTTGCTGCTGCTGCTCGTGGTCGAGCTCGTCGTCGTCGTCATCGTCGTCGTCGTCGTCGTCATCGTCGCTCGAGGATTC
GTCCGACGACTTGCTCGTGCTCGGCCGCAGCGTCGGCGACGTCCCCGACGATGGCTTTTGCTGCTGGCGGAGCGCGGCCTTGCGCTCTTTCGTGCGCTGG
CGCTTCTTTTGCCGCTTGTTGCGCTTGGACGCTTGCTTGGCCTGCTTCTCGGTCGTCTCCTTCTCCGTCTCCTCCTTCCAGAGACTCTCTTGGTACTTGA
GGTGGAAGATCGTGCAGTCGCAGTTCTTGCACACGTTGCACTTGCACTCGGCGCAAAAGAATGTGTCGTTCGAGTGTTTCGAGAAGGCGCCCATGCAGAT
CGCGCACGTCACAAAGTGCTGCTGCCATATCCGCGTCGCTCTAATGCGTCGTGGGTCCTTGATACCTTGATACAAAGTACATACCGCTTCGCGACCGTCG
CCGACTTGTGGGACACGAGGGTTTCAATGTTGGCCGATGCCATCAAGCCAGCGTACGGGTTGGGCGCGTCGAGTCGCTTGGCCTCGAGCTCGCCCACTTG
CAGTATACGCTCGAGGCCTTCCAGCGCCATCATGACCATGCTCGTCTCTTCCAGTAGGTTGCCTAAGATCTGGATGCAGCCTTCGTTGACCAAGTATTCA
ATCTACATAGAAATAGAAGCGGTGAGATCCCAGCATATTGGCGTCAAAAGGACCGACTTGACTATCGGAGCCGCACGACGTCGCGTTGAGGACGACCCAG
CACGCTTCGGAGCGCACCTCCGTGTCGGTGGCGTCCGACGACGCGAGGTTCATGAGCGACGGGATGCAGCCAGAGTCGAGCACGCATTGAATCTGGTCGA
CCGTGCCCGCGGCAATGTTGGAGAGCGTCCAGCACGCCTCCTTTTGGATCTCGCGGTTCGAATGCGCAATGAGCTTGCGCAGCGATGGCACCGCGCCACA
CTCGATGATATGCTACACGACATGTCAACCGGTTGCGAGGTATGCAGCGTCGACGCTACCTGGGTGTAGTCGTGGTCGTCCTCGGCGCAGACAATGTTGC
CAATGGCACGCAGCGCAGGCTTGGTCACGCGCCACGAGTTGTGGCTGAGCAGCTCCACGAGGCGCAAGCACACTTCCGAGTCGACGACGGCCTGGATGTG
CGTGCTCGGGCCGTCGCAGAGGTGTGAGAAGGCCCAGCACACGTGGCTCAGCACTTCCGTGTCCGAGCTCGCCAGCATCTACGTTGCTTGCATTCAAAAA
TGGAAACGCAACGCGGTGCTGGTACCTTGCCGAGCGACGGAAGGACCAAGTTGATGTCAAAAACTGGTCGCGGCTGGCCGTCACAGAGGTTGCTCAGCGT
CCACGTGAGGATACGCAGGAGCGAGAGCTTCTCGGGCGGCGCTTTCTTGAGGCTGTTGACGAGGGGCGGCAGCGCGCCCGCCGAGAGCACCGAGTCGCGC
GTGTGCGAGCCTTCGCCAGCCAAGTTGCCCAGCACCCAGACAGACTGCTCGAGGACCTGCAACAATGCCATGTTGAACCAAGGGCGACTGCAACATCGAT
GGTTGTACCTCTTCGTTGGGCGAGTCGAGGAGCGACACGAGCGTCGGGATGACGCCATTGTTGAGGAGCACGGACGTATTGTCCGTGGCGCCGGCGGCAA
TGTTGGTGAGCGCCCAGAGCGCCTCCACTTGCAGAAGCGGGTGGTCCTTCAATTTCAGCCAGCTAATGAGGCGCGGGGTCCAGTTTTTCTCAAGCATCTA
CGACCGCGTCAAGCGTGCGCCATGGGCTACGTGGCGCATCCCACCTGCCGGATCAGGAGGTCGCGCTCGCTCGAAAGGAGGAGGCGCAGCTTCTTCGCCG
CTTCCATCTGGACCGTCGAATCTTGGGACGAGAGCCCGGCGTCGATCTGCGCAATGTCGCCCTGGAAGTCCTTGTTGCCGGCCATCGCGGCCGAGTGGGC
AGCCGAGAGCGCTTGGATCCCGCTGCTAGCGAGGTGGACCATCGAGCTCGCGCTCATCGAGTGGGCGAAGGCCGCGGGGTGGTGGTGGGGCGCCTGGCGC
GCCTTGGACGGGGGGAGCAGCGAGGCCAGCGACGTCGAGGTAGACGCGGGGGATGGCATCGGTCTCGACGGGATGCTAGCGATCGAGCGGAGGAACGCGG
ACGGGTCGATGGACGCGGCAGGAGCGGCAGTCAGGGGATCGACTTCCGCCGACGCTGACCAGAACCTTGTACTGTTAGCCATCCCAAAACTTTATCCCGT
CGAATAATAAGTTTTCCCGCAATTTCACCGGCTGAACAAACCTCTACAAATGCATACTCAAAAATCCATCGAAGAAAGCATCTCAAGCGACATCGCATTG
GTGCTACCGCCGTACACGTCCCGTCTTGGGTAGGCTTGCGCCCACGACCTCGTCGTCTCCAATTCCACGAGGTTGCCTGCGCTCGAGTTCCGTCGTCGCA
CCATGTAAATATGTAAAATCCCTAAATTGTGGAAAATGGGCGTTTTGAGATCCATGGAATTGAGTTTCAATGAGGGCACCCGGCCGCATCGGTATCGAGT
AGCTTGCAAGGGTGAGAGACGAGAGAAGGATACTCTAGACGCCATCGCGTTTTGCCACCATAGTATGGGACGGCAAGCATGCACAACACCGGGAAGCGCT
CGCGGTTTAAGTACCACGTTTTCTGAAACTCAAAAAACGCAGCTCAAAACCAGCTGTCCGACCTGCAGCATTGCATATTCGAAATCTTTGTTATCCGGAT
CTACCGGATAACCGACAGACGCGCGCGATGACCGCCAGTGTTTAAAACCGTCCAAGATCGCACTGCCGCGTGGACAATGTCCTGTGGACTAAGTTCTCGG
ACAATCGGCCACTCAGATCTAGGACGGGCGTGGTGGTTGAGTAGACAAGTTGTCTATTGCCAAGTACGAGAACCTTGGGGACAGGACACGGCGACTCCGA
CGACGGCGCTCTGGCGTACAGACACCTCTCGCATCCTCGCTCCATCGCATCGCAACCTACCGGTACTCGTATGAACAACAACTCAACTTATTGACGCCGC
CGAGAGCATGACGAGCGTGGCGCAGCCCCTCGTGCACGGGTTCCAGCAGTATTGCAACACAGCGCGGCGAGGACGAGCTTCGAGTCGGTGCGGCTATGGT
TAGTCCTGCCCAAAGATATGTATACCAGTCGCATCATACCAGCGGGCGCATGCAAGAGTGCTCAGCATTAGTCGACGTACGTCTCGCACGAACGAGACCA
AGGCGACACTTGCCGTGAGTCGGACACGTCTTCTGCTTGCTACAAGATATTCCACGGACGTCACTGGGCACCCTCAGTGCCCTGGTGCAGCCACGCCTCA
AACGTGTGCGACACAAACTGCGCTGGCAACAACCCCATCGGATCAACAACCAAATGAATGCAACAAAGACAGCAACACGACCGCGATCCCAGCGTGGGTG
ACACCCGTGCGTCTCGAAGCTAGTTTCGACATCTTGTCATCCATCTTGGAGTCGACGATTTAGAGAACACCAACCTCAGTCCATTAACTTAAATGTCTAG
TCCGATATGCGGTAGTGGATTATAGAGTACATCGGAACAAACGCGTTAGGCCTCCATGACAGCCACGTGCGTCTCGCGGCGCGCAATGCCAATCGCGAGC
TTCTTTTTGAGCAATTTTCGGCGCGACACTTCGACCGCGATCGCGGCCAGGACGATCGCCCAAATGAGCCAGAGGTACGGAAACAACAGCGTTTGCTTGA
GCCCGTCCCGGTCATTGGCGCAGAGCGGGTTGAGCGAGACGCCGTCCTCGAGCGTATTGCAGTGCGGCGCCCACTTGTCCTTGAGCATACCAAGCACGAT
GGGCGAGGGCACGTCGCCGAGGACGTGCGCGAGGAGCGTGTTGATACCGAGGGCGAGGCCGCGCCGGCGCTTGTCGACCGAGAGCAGAATGGCCACGACC
GACGCCGGGACGCACCCAAAGAGAAACGCGAGCGCGATCGCAAGGATGCCGATCGACAAGATCTTATCCCACTCGAGCGCGATCCACGAGAGGACAAGGA
ACGCCGTGCCGGTCGCGAGCATTATACACAGCTGCCGCGTCGCCTTGTACATGCGAAACTCTTCGTTGTCCGGGTCCAGCGCACACGACCGGTCGAGGAA
GAGGCCGCCGAGAAGCGTGCCGATCGTACCAGCGACGACGATGATGGCGCCAAACACCATGGCGGCCGAGCTCTCCTCAAAGAGGCCAAGGCCGATCAAG
AGCGATGGACCAAACGCACCGAGGCCCGAGATGGAGAAGATGTACGCGGCCGACCCGAGGGCGACGAGCATAAAGAGCGGCGACATGAGAATCGAAAACA
CTTCCATGTGCAGAGCGACCTTCTTGACCTCGGGCTCTTCGTCCGTGACTTGAGCGACTAGTGAAAAGGTCGACTGCATGATGCATTCATGCGAGAGGTC
GTTGGCGGCCAAGTCGGCGTCCGCGGTACCTTGGTGGAACTCGACCGTCGCGCGGTGCGGATCCTGGAGCTGCGGCGTCATGGTGTGGGCGCGCTGGCGA
GCGACCAAGCCCGCGGGCACGTTGTACTGGTTGGGAATGCTAAAGATGCAGAGAAGCACGAGCGGTACCATGAGGATACCCTCAAAGTGAAAGGCCCACG
GCCACCCGATTGTGGACGCAAAGAGTGCCGAATAAAAGTAGCCCGCCGCCGTGCCGACCGTGATGCCGCAGTAGAAGACGCCGAGCCAGAGCGTGCGCTT
CGCCGGCGGCGCGTGGTCGTCAATGAAAGATGGCGCAATTGCTTGGAAGCTCGATTCGCCGACGCCACTGAGAATGCGCCCGACGAGGAGCACGTTGAGG
TTGTTGAACGGCTCGGCGAGGCCGCAGAGCACCATGGCCACGCACCACGTGGCCATACCGGCAGCGATGAGCACGAACGGGCGATAGTAGATAACCCAGT
ACCCAAACGCAATGCTAAAGACCGAGTAGCCCGCAATGAACGCCGAGACGAGGAGACCCATGTACGTGTTGGCCTCGGCGGTGCCCTCCTTGTCGAGCGC
CTTGTTGATGAAGCTCTGGAACGTGTTGGGCGACCCGGGGATGATGCCCCGGTCAATGTAGTTGAGCATGTTGATGGTGCAGAGGAGCACAAAGAGGCTC
GAGACCTTGGTGAGGCGGACCATGCTGCTACAACCCCGAGCGTATTGCCAACTGCACCTTCTACCAGCGTGCCCGCGGCTGCTGCAAGGCCATTGGCTGA
CGCGAATGCATTCGAACTTCGATGCGTGCACATGATTGTAGGGCAAAGTGGGCGCTCGAAGGAAAAAACCGTAGATATTAACGTGAATACTTCCATTAAA
ATTATTAAAATGGATATTGTAATATTTCGATAATGTGAAAGATTACAGCGCGTGCCACGTCCAGGCGGTCGACGCAGCGCTCACGATGGCAACGCGGTTG
GGATCCCTGACGCAGAGTACAGCGTTTGCAAGCACAAGCAAGACAGGCTCTGTCGCAGGAATAGGTCGAAGCGCGACCGCCGGATGCATGCCATAAGGCG
CGAATAGTAATATGAATATGGATATTATCTGCCGCGAAATAATATTAGCGTCGACGCCAAATTTGTCCCGTCCCATCTGATATGGCAAGTCTCTGAAACT
TGATGCGTGCCCGTTGATGTTGATGATGCACTGGAAGCTTAGGCGTGCGTCGCCGACTTGGCAGTCCCGGTAGCGGCACCACATACAAGCCTCGCCATCG
AGCTCAACCAAGATCTGAGCCGACTCGAAGTCGTAGAGACGCGTCTGGCACTGAGAGCCATATTGCACTTCTTTCGAACCTGACGTGGGCATGGACCAAA
GAGCCAGCGCCTCCTTGTTCGACGATCATTGGGGGCTTGCACATCTGTCTACTTCCGGTGGGGAGTTAAGGAGTCCTGGGCTTGCCAGCGCACGGCCGAC
GTGCTGCAACGCGCTGCTGGCGAAGAGAGCTGCAACAAAAACGTGCAGACTCTGCGGCGTTTAGTGCGCGGAGGAGCGCGATAGGACCAATCGAGATGCT
ACGCTCCTGACCCAACACCGCTGTAATGCCCTGCCAGCGTTCCTGCGATGCTGCTCGCCACGTTCCGAAGCGTGCGCCAGAACGAGATCGTACCAGAGCC
CCTGCTAGAGCCTGCCTCCTGCGCCAGTTTGAGACTCTGCCGTGGCTTTGGCCACAAGCCGCCGACTTGGATAATAAACCACCCAGATTCCAAGCCGAGA
GCAGGCAGCATAGCAGGGTTCTATTTGACAGCAGCGAGGCGACCGTGCAACTCTTGGCGTCGTCATATCCTCCCGTCCTGGTTCTGGGAACGCGTCTTGG
GCCAACATATTAAATTTGACAGGTTTTACAGGTCAACCAATGGGATGGCGCGACGCATGGGAAAGATACTGGTATGCTGACCGAGATCGCGGTGCGGGTG
GCCAAGGTCGACGACGCATCGTGCCTCAACGACGACAACGACGAGACCAAGCCGACGGGGCCGCGCGTGAAGCGGGTGCAGGTCACGCTGCT