Description :
From Genome Similarity Track
Location :
Scaffold_33:127450- 129618
Sequence
2168 bases(100 bases per row)
GAACCATAAAAAAATGGTCGGGGTCAGTAGGGGCGGAGCGCCCTACTGATCCAGCAACCTCAAGAGAATTTGCAAATCTCTTGACGAAAGTTGCTCCAGA
TACACAATCATTGTGTGTCTCTGCACCTAGTGATGAGGTATCACCGATTACCTTGGAATTGAAAATGACAAATGATTTGTCACTTCGTGCTCTAGTCGAC
TGTGGGGCGTCGAACAACTTTGCTCGTCGTCAGTCGCTAAAGGGTCGTATGCTCAAGTTCGTTGAGCGCGACATCCCCCCGACGAGGATGACGGTGTGCC
TTGCCACAGGCGCTTCGATAACCGTTGAGAAACGTGTAGGTGGAATCCACAACACGTTAGAGGGCAAACAGTACAATGATGATTTCATCGTACTGGATCT
AAATGACATATTTGATGTCATCCTGGGATTACCTTGGCTCGCAAGGTACGAGCCAAGAGTGAGCTGGCAGCATCGATCCGTGAAGATGCCTGCCGCTTGT
TCATCTGATGGCCATCTGATGAACGTCATGGAGCGTCCACAAGCGTGTGGATATACTGCAAGTGAGTGCGATGGCCTCACTTGCGGTAAGGTTGTTAGCA
CGACTTCCAAGACCTAAGTGTAGCTGATCCCTACACTTTGGAGGAATCTGTCGGCGGCTGTGCGAATGCACAGGCAGTGCCGAAGGTCCACCACTCGAAT
AAGTCGAGTATATCGGGACATGGATGCATGCCTAGCGAAAAACATCCTAGGAAGAAGAAACCGGTTGCCACCAAAGGGCAACACGGTCATCCTAGGTCGA
CTGGAGAGTTGACCGTAGAGGATCGGTACCTGACTGTGGTTGCACAGCCACATTCAGAAGACGTCGAGGGAATAAGTCCCCACGTACTGGAGGAAGGAAT
TCCTCAAGCAGTTACATGCTGAGAGAACAGGCTCTCAGAAACCTGAGGAAACAAGTTCTCAGGAAGAAACCGAGACATTGAATATCTTGGTTAATGACGG
ATAAAGCGTAGGCGCTTATACACTTGATCTGATCGCGCCTCCGAAGTTGACTTCGGAGATCACTCAATTGTCAATGCTGGAACCGAAACGGTTCCTGCTT
GATCTGCGTAGTGGCAAGGTCAAGCAGGTCTGCATACTCGTCACAGAGGATGATTATGTGACCGATATTTGGTCAGCATCAGTATTTGCTGAGAGCGAAC
GGGTTCTCAGCAGCTCATCGATGGAAGAAAGTGTCCTCGATGAGAAGACTCGAATTGAGTGATACACGTATAAATCAGTCGCTTCAGGCAAATCCTTTGT
ATAAGGATTTGATCGAATTCAAGGATGTGTTCCCTGAATCCGTGCCATGCGAATTGCCTAAGGATAAAGACACTCGACATGAAATCAAGCTCAAACCGGG
CTCGAAGTACTGTGTCATGAAGCAGTGGCCACTGCCTCGTGAACAAGTACTAGCGATCGACAAGTTCTTTGCTGATCGCTTTGCATCGGGTCATGTGAGG
GAGTCAACTTCGCTTCACAGCTCTCGGACCTTCTGTGTGCGCAAGGCCTCAGGAAGATGGCGGATAGTACACGCATTCAACAAGATGAATGATGTAACGG
TACCGTCGTAGACGCCGTTACCGAGGAAGGACGTAATCATTGATGATCTGTCAAAGAGTACCATCTTTTCGTCCATGGATCTGATGGATGGCTTCTATCA
GATCCTAATGCGTGAACGGGACATCCCGTACACGGCAGTAAGCACCCCGAGCGGCATGCTTTGGGAGTGGCTAGTGATGCCATAGGGGCGGAGTAACGCC
CCTGCCACCTTCAGCAGATTTGTTACAAACCTATTGCGACTGGTGCAGGATTTTCACCGAGTTGCTGTGAATATTTGTTCGTCCATAGCCGGGCTATGAA
TGGGAAGACGGACGTGGAAGTTCACAGAACACATGCTCGTCAGGTCTTCAACTTATGCAGAAGCATAAGTTGCATGCCAATATCAAGAAGTGTATATTTG
CGGCTAGCGAAATACCACCTCTTAGGTGCATCGTAGGTAAACACGGCGTACGCCGTGATTCCGAAAAGATCAAGGCGATCACCGACTGGTCTGTGACAGT
CGATGTCAAGGGACCAAGAAAGTTTCTTGGGCTAGTGGCATACTTGTACAAGTACCCGCACATCTATG