Description :
From Genome Similarity Track
Location :
Scaffold_11:127449- 130359
Transcript NameFunction/comments
g4047.t1hypothetical protein

Sequence
2910 bases(100 bases per row)
TCCTTCGTGCCAGTCAAAGTCAGCTCCGTCACCTCCGACACCACCGAGTTCTTCACCGAGAACAACGACGAGAAGTCCACCGTCGCCGGCTGCGACAGCG
TCGAGTGCTCCTCCACTGCGTACAAGTGCGACAGACGCACCAGCAGACACTGCTTCGACAGCTCCTGCAGCGTCGTGAGACCCACGTTCGGAGGGAACTC
ACCCACTGCTAGCCACGGCACCTTCGCCTCCACTCCAGATGCCACGGGTTTGCGGAACACCGCCAGAGGACGGAAGAACTGCGACTCCATCTTTGACCGC
AGACTGCGCATGCCGTCCTCCGCAGAGTCCACGTTGACGAAGAAGTTGCCGCGCACCGCCAGACCCTTCGTCACCAGCTTCTTGTTCGCCGAGTCGTACA
CGGCCTCCGTCTCGTTCAGGTGCTCGCCCACGCCCTTGTCGTCATCCGCCAGCAAACGTCGGTGCACCATCACCTCCACCTGACCGTCAACCAGACTCGC
CGCACCCTGCGCACGGTCCGTCACCACGTTCAGCTGCCGCTTCGCGTCCTTAATGTACGCTCCCGTCGTGATGGGGAAGTAGTTGGCCGCCACCGTCTCC
TGATTGTCGTGCAGCGTCAGGTTCCACGTGTCGCGGTGGTTGCGCACGCGCTTCATGAACTCCAGACCGTTCGAGTCCGTGTACAGCGTGCTGTCGGACG
CGATGCTGTTGCCCGCGTCGAAGCGTACGATGACCTCCTTGCCCTTCTTATCGTCGATGGGAACCGGTCCAACGGTCCACTCGATCTCCAGGAACTCGTC
ATCGTCGTTCACACGGTACTCCAGTGTGACCCACTTGCCGATTTTGAACGCCACGCGTGGCACGCTACCCAGGCGGTTACTACCAGAAACACCACTCGTC
TGCAGCTCCACCATCGTCACGTCCGGCACCGCAGACGCTGCCGTGCCGCTACCGCCAATCACGGGGTACGTCTGGTTCGAGTCGGGACGGAACACGTACG
CGCCAGACTTGTGTCCGTCGCCTTGGAATGCCTGGTAGTACGCCACGTCCAGCGATAGCGGGATCTGGATGTTCTTCTTCTTGTTGGCCAACTTCGTGAT
GGACCCCGTCTTCTTGCTCACCTCGGCGCGCAGCAGGTGGTTCTCCAGCACAACAACGTCCTCATCGTCGCTGTACTTGTCGTCGTCGAGACTACCAGCA
CCCTCGTTTCCACGCTCATATTCGACACCTTCTCGAACGTTGCTGTCGTCGCTGGCATCCTTCTGCTTCACCAGGAATCGAGCCGTGCTCAACGGCTTCA
GCTCCACACTGAATACGAACGAGTTCGGAGCCACAGACGTCTCCGGGTGCACTGGCACAGCCACGTACACGTTCTGCTCGCGGAGTCTCGCATCCCCCGA
CAAAAGCTGCGCCTCCGCCGACCTGTGCGTGATCGGAACTGACAGCGTTTGCACACTGGTACGCGCCAAGGCGTTGTGCACCAGCACCTCAAAGTCAGTG
TTCTGCGTGGACACATCACAGACGCTCGTGTTGGCCAACAGACAGAAGTGGTATGGCTCCTTCTCGCCGATCACGAAGAGCACCTCGTTCAGTTCCTTCT
CCGCCTGAATGATGCCGTCGTTCAGCCGCAGCGCGTAGTCGTCGGCAACGCTTTGTTTCTCCGTGCCGGAGAGACCATCGTGGTGCTGCACGAGACCAAC
AGCCCGTTGTAGTGCCACCAACTCGCTCGAGTGGTGGCTTTGGTACACGGCGTCCAATTGACGCACCTGCTGCAGGAGAGTGTTGGCAACGCGAGCGAAC
CGCTTCAAGGTTGGCCGACTCGTGAAGAATCCCGACCAGTAGTCATCTTGGTCGGACGCGTACGGCATGAAGTCGTCCGTCTTGACGCTCCAAGTTAAAC
CTTCTGCATGCTTCACGTCCGTGTAGTACGACAGGTTCGAGTAGAGCACGTTGACTCGCGCGTCCTGGTTGACGTAGTGGATGAGTTTGTCCATATTCTT
GAACCAGTGTCTCGAGTTGTCATACTGGAAGTCACAGCCCATGGGGATGAAGACATGGTTGCCCTTGGACGCGCCACCACGCATCTTGGCGTTATTGACG
AACTGCTCCACTTCATCGCAGACATCATAGTCGTGCAGGTCTGCATCATCTTGGATCTCATTGCCATTATTGCCGAAGTCGAATTTGCCAGGAGGGCAGT
AGTGGTCAATGATCTCACCCGTGAACACCTGCGACTCCTTACCGCGAGACTTGCTCGGACGCCAAATGAACTCCAGATCCTTGTTCTTCTTCCTCAGACC
GTAGTCCTGGTAGTCCATGCGCGCGAAGTACAGAGCATCAAAGCCCACGCCCTGCGACAACAACGAGCCCTGTGTGGCAGAGTGGCCGAACGGATCGATC
TGCCACCCGATGCGCGGACTGATGCCGAACTCATCCATGAGCAGCTGGTGGCCGTACGCCGTCTGGTCCACCATGGCGATGTAGTGCGGCGTGGCCTCGT
CGTGCATGCACCAGCCGCCGTTGACCGTGAGGTCCAGCCGTCCCTCCTTCACGAGCTGCTTGACGACGCCTTGCACCTCGGAGCCCTGCTCGTGCCACCA
GCGCTGGAAGAAGGACTGCTCCACGAACATGAACTGGCGGTCTGGGTTGCGCACGAGTTCCTCCACGGCCGTGTCCAGGATGTACTGCACCTTCTCCATG
TAGTACTGGTCCACCCCCATCAGCCAGCCCCTAACAGCAACAGAGTCAACATGTTAGTATAGATAATATAGTTTTGCAATATGCTGGTGTGGGCGTACGG
GTCGTCGTGGGAGTGCGCGATGAGGTGCACATTGAGTTTGTTGGGGTCGATTTGGCTGGAGGTGTTGTACACGCCGTCGCTGGGTGGCGTCCACTTGCTC
GGGTCGCAGG